ID: 992093861

View in Genome Browser
Species Human (GRCh38)
Location 5:73342436-73342458
Sequence CAGACTAGCAAGGAAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992093861_992093865 21 Left 992093861 5:73342436-73342458 CCTGCTACTTCCTTGCTAGTCTG No data
Right 992093865 5:73342480-73342502 AAAGAGTCAGGGAAACTTAAAGG No data
992093861_992093864 10 Left 992093861 5:73342436-73342458 CCTGCTACTTCCTTGCTAGTCTG No data
Right 992093864 5:73342469-73342491 AATATGAGCAAAAAGAGTCAGGG No data
992093861_992093863 9 Left 992093861 5:73342436-73342458 CCTGCTACTTCCTTGCTAGTCTG No data
Right 992093863 5:73342468-73342490 TAATATGAGCAAAAAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992093861 Original CRISPR CAGACTAGCAAGGAAGTAGC AGG (reversed) Intergenic
No off target data available for this crispr