ID: 992095510

View in Genome Browser
Species Human (GRCh38)
Location 5:73358980-73359002
Sequence TGGGGTGCCCTTACAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992095510_992095516 -1 Left 992095510 5:73358980-73359002 CCTCTTTTTGTAAGGGCACCCCA No data
Right 992095516 5:73359002-73359024 ATCATGAGGGCCCCACCCAAAGG No data
992095510_992095524 29 Left 992095510 5:73358980-73359002 CCTCTTTTTGTAAGGGCACCCCA No data
Right 992095524 5:73359032-73359054 TCTAAATGCCATTACATTGTGGG No data
992095510_992095523 28 Left 992095510 5:73358980-73359002 CCTCTTTTTGTAAGGGCACCCCA No data
Right 992095523 5:73359031-73359053 CTCTAAATGCCATTACATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992095510 Original CRISPR TGGGGTGCCCTTACAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr