ID: 992098220

View in Genome Browser
Species Human (GRCh38)
Location 5:73381756-73381778
Sequence CCCGGCCGCAGGGATTTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992098213_992098220 4 Left 992098213 5:73381729-73381751 CCGCGCCACAGGCAAAAATTGCG No data
Right 992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG No data
992098207_992098220 28 Left 992098207 5:73381705-73381727 CCATCCGGGCCGACGAGGTCAGG No data
Right 992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG No data
992098209_992098220 24 Left 992098209 5:73381709-73381731 CCGGGCCGACGAGGTCAGGCCCG No data
Right 992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG No data
992098212_992098220 5 Left 992098212 5:73381728-73381750 CCCGCGCCACAGGCAAAAATTGC No data
Right 992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG No data
992098210_992098220 19 Left 992098210 5:73381714-73381736 CCGACGAGGTCAGGCCCGCGCCA No data
Right 992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG No data
992098214_992098220 -1 Left 992098214 5:73381734-73381756 CCACAGGCAAAAATTGCGCAAGC No data
Right 992098220 5:73381756-73381778 CCCGGCCGCAGGGATTTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992098220 Original CRISPR CCCGGCCGCAGGGATTTCGC GGG Intergenic
No off target data available for this crispr