ID: 992102016

View in Genome Browser
Species Human (GRCh38)
Location 5:73417344-73417366
Sequence ATTGAAGCAAAGACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992102011_992102016 24 Left 992102011 5:73417297-73417319 CCCAGTTAAGGATAGTAAGGAAA No data
Right 992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG No data
992102013_992102016 -5 Left 992102013 5:73417326-73417348 CCCTGAAAGCTCACATTGATTGA No data
Right 992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG No data
992102014_992102016 -6 Left 992102014 5:73417327-73417349 CCTGAAAGCTCACATTGATTGAA No data
Right 992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG No data
992102012_992102016 23 Left 992102012 5:73417298-73417320 CCAGTTAAGGATAGTAAGGAAAA No data
Right 992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992102016 Original CRISPR ATTGAAGCAAAGACAGAGCT GGG Intergenic
No off target data available for this crispr