ID: 992102833

View in Genome Browser
Species Human (GRCh38)
Location 5:73423705-73423727
Sequence CAGAACAAAGAGAACAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992102829_992102833 22 Left 992102829 5:73423660-73423682 CCTACTATGACAATCTTTGGTGT No data
Right 992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG No data
992102827_992102833 25 Left 992102827 5:73423657-73423679 CCTCCTACTATGACAATCTTTGG No data
Right 992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992102833 Original CRISPR CAGAACAAAGAGAACAGGAC AGG Intergenic
No off target data available for this crispr