ID: 992103111

View in Genome Browser
Species Human (GRCh38)
Location 5:73426394-73426416
Sequence GGTGGTGCCTGTCCACATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992103111_992103119 19 Left 992103111 5:73426394-73426416 CCTCTATGTGGACAGGCACCACC No data
Right 992103119 5:73426436-73426458 AAAGAACCAAAAAAAAGCAGAGG No data
992103111_992103120 24 Left 992103111 5:73426394-73426416 CCTCTATGTGGACAGGCACCACC No data
Right 992103120 5:73426441-73426463 ACCAAAAAAAAGCAGAGGAAAGG No data
992103111_992103122 27 Left 992103111 5:73426394-73426416 CCTCTATGTGGACAGGCACCACC No data
Right 992103122 5:73426444-73426466 AAAAAAAAGCAGAGGAAAGGTGG No data
992103111_992103112 -9 Left 992103111 5:73426394-73426416 CCTCTATGTGGACAGGCACCACC No data
Right 992103112 5:73426408-73426430 GGCACCACCCAATCACCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992103111 Original CRISPR GGTGGTGCCTGTCCACATAG AGG (reversed) Intergenic