ID: 992104212

View in Genome Browser
Species Human (GRCh38)
Location 5:73436832-73436854
Sequence GGTGAGGAAGGGGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992104212_992104220 -9 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104220 5:73436846-73436868 TTCCTCACCCGGAAAATCGTGGG No data
992104212_992104229 20 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104229 5:73436875-73436897 CGGCGTAGCGGCCGGACCCCTGG No data
992104212_992104227 8 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104227 5:73436863-73436885 CGTGGGGAGGCGCGGCGTAGCGG No data
992104212_992104228 12 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104228 5:73436867-73436889 GGGAGGCGCGGCGTAGCGGCCGG No data
992104212_992104219 -10 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104219 5:73436845-73436867 CTTCCTCACCCGGAAAATCGTGG No data
992104212_992104221 -8 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104221 5:73436847-73436869 TCCTCACCCGGAAAATCGTGGGG No data
992104212_992104226 0 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104226 5:73436855-73436877 CGGAAAATCGTGGGGAGGCGCGG No data
992104212_992104223 -5 Left 992104212 5:73436832-73436854 CCCGCGGCCGCCCCTTCCTCACC No data
Right 992104223 5:73436850-73436872 TCACCCGGAAAATCGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992104212 Original CRISPR GGTGAGGAAGGGGCGGCCGC GGG (reversed) Intergenic
No off target data available for this crispr