ID: 992105871 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:73448495-73448517 |
| Sequence | CGGCAGCCCCGGCGCAGCTC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 280 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 20, 4: 256} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 992105871_992105880 | 28 | Left | 992105871 | 5:73448495-73448517 | CCGGAGCTGCGCCGGGGCTGCCG | 0: 1 1: 0 2: 3 3: 20 4: 256 |
||
| Right | 992105880 | 5:73448546-73448568 | TTATAACTCCTGCGCCGCCGCGG | 0: 1 1: 0 2: 0 3: 1 4: 7 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 992105871 | Original CRISPR | CGGCAGCCCCGGCGCAGCTC CGG (reversed) | Intergenic | ||