ID: 992105871

View in Genome Browser
Species Human (GRCh38)
Location 5:73448495-73448517
Sequence CGGCAGCCCCGGCGCAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992105871_992105880 28 Left 992105871 5:73448495-73448517 CCGGAGCTGCGCCGGGGCTGCCG 0: 1
1: 0
2: 3
3: 20
4: 256
Right 992105880 5:73448546-73448568 TTATAACTCCTGCGCCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992105871 Original CRISPR CGGCAGCCCCGGCGCAGCTC CGG (reversed) Intergenic
900513373 1:3070439-3070461 CCGCAGCCCCGCCGAAGCCCCGG + Intronic
900574947 1:3378484-3378506 GGGCAGCCATGGCACAGCTCTGG + Intronic
900782784 1:4628857-4628879 GGGCAGTCCCGGGGCAGCTAGGG + Intergenic
901448618 1:9323073-9323095 CGGCCGCCCCTCCCCAGCTCCGG + Intronic
902756085 1:18550139-18550161 CAGCAGGCCTGGCGGAGCTCTGG - Intergenic
903349610 1:22710225-22710247 CGGAGGCCCCGGCCCAGCCCCGG + Intergenic
903405478 1:23091831-23091853 CAGCAGCCCCAGAGCTGCTCCGG - Exonic
903781510 1:25823054-25823076 AGGCAGCCACTGGGCAGCTCCGG - Exonic
903884287 1:26531898-26531920 GGGCAGCCACGGCGCAGGTTGGG + Intronic
904086720 1:27914515-27914537 CGGCCGCCACTGCGCCGCTCTGG + Exonic
904252951 1:29237747-29237769 CCGCAGCCCCGGCGCCGCCTCGG - Intronic
904316542 1:29669798-29669820 GGGCAGCCCCTGCCCAGCACTGG - Intergenic
904383245 1:30125403-30125425 GGGCAGCCCCTGCCCAGCACTGG + Intergenic
904449133 1:30599829-30599851 CGGGAGCCACGGCAAAGCTCTGG + Intergenic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
905919034 1:41707127-41707149 GGGCAGCCCCGGGGGAGCTGAGG - Intronic
907022834 1:51086058-51086080 GGGCAGCACTGGCCCAGCTCTGG + Intergenic
910679100 1:89844037-89844059 TGGCAGCTCCAGCGCAGCCCGGG - Intronic
910936101 1:92485426-92485448 CGCCAGCCCAGACCCAGCTCCGG - Intronic
914813879 1:151048753-151048775 CGCCAGCCCCTGCCCAGCCCTGG + Exonic
915951190 1:160190777-160190799 CCGCAGACCCGGCACAGCTCTGG - Exonic
919070689 1:192751496-192751518 GGGCAGCTCCGCCGCAGCCCTGG + Intergenic
919465943 1:197921673-197921695 CCTCACCCCCGGCGCAGCCCCGG + Intronic
919826483 1:201506971-201506993 TGCCAGCCCCGCCGCAGCCCCGG - Intronic
1062769090 10:85609-85631 CTGGAGCCCTGGCCCAGCTCTGG + Intergenic
1065726045 10:28668816-28668838 GGGCCGCCCGTGCGCAGCTCCGG - Intergenic
1066022777 10:31319587-31319609 CCGCATCCCCGGCGCAGGGCGGG + Intronic
1066189397 10:33042141-33042163 AGGCTGCCCCAGGGCAGCTCAGG + Intergenic
1067570640 10:47368693-47368715 TTGCAGCCCCGGCCCAGCTCAGG + Exonic
1069957433 10:72060653-72060675 CTCCAGCCCCGGCTCAGTTCAGG - Exonic
1071515313 10:86293086-86293108 AGGCAGCGCCGGCACAGCTAGGG - Intronic
1071546780 10:86535617-86535639 GGGCGGCTGCGGCGCAGCTCTGG - Intergenic
1072802527 10:98403075-98403097 GGGCAGGCTCGCCGCAGCTCTGG + Intronic
1073363292 10:102917675-102917697 CGGTGGCCCCGGCACAGCTGCGG - Intergenic
1075745625 10:124725328-124725350 CAGCAGCCCCGGCTGGGCTCAGG + Intronic
1076316565 10:129546211-129546233 CTGCAGCCCAAGCCCAGCTCAGG + Intronic
1076722965 10:132400755-132400777 AGGCAGCCTCAGCGCAGCGCAGG - Intronic
1076834934 10:133016302-133016324 CGGAGGCCCCGGCTCAGCGCCGG - Intergenic
1076999539 11:315784-315806 CGGGAGCCCCGCGGGAGCTCGGG + Intergenic
1077074723 11:695136-695158 GGGCGGCCTCGGCCCAGCTCGGG - Exonic
1077228761 11:1449520-1449542 CAGCAGCCCAGGCACAGCACAGG - Intronic
1077326043 11:1964520-1964542 CGGCAGCCCTCGCGCGGCCCAGG + Intronic
1078164564 11:8871072-8871094 CTGCAGCCCGGCCGCAGCCCGGG - Intronic
1079122518 11:17695914-17695936 CCGCAGCCCCGGCCCGGCCCCGG - Intergenic
1082816999 11:57515536-57515558 CCCCAGCGCCGGCGCGGCTCAGG - Exonic
1083951510 11:65959145-65959167 CGGCAGCCCTGGTGCAGAGCAGG + Intronic
1084128594 11:67117921-67117943 GGGCAGGGCCGGCGCAGCTCGGG + Intergenic
1084583829 11:70042235-70042257 CAGCAGCCCTGAGGCAGCTCAGG + Intergenic
1085464537 11:76714936-76714958 AGGCAGCTTGGGCGCAGCTCAGG + Intergenic
1089325162 11:117651969-117651991 GGGCAGCCCAGGCTCACCTCTGG + Intronic
1089993414 11:122882871-122882893 CGCCCGCCCCGGCGCTGCCCTGG - Exonic
1090784103 11:130033238-130033260 CGGCCGCGCCGGCGCAGCGAGGG - Intergenic
1202809023 11_KI270721v1_random:19699-19721 CGGCAGCCCTCGCGCGGCCCAGG + Intergenic
1091686515 12:2566588-2566610 CGGCGGCCCCAGCTCTGCTCTGG + Intronic
1091778824 12:3201073-3201095 CGCCGGCCTCGGCGCGGCTCTGG - Intronic
1091879195 12:3963010-3963032 GGGCAACCCTGGCCCAGCTCAGG - Intergenic
1092426375 12:8378909-8378931 CTGCAGCCCCGGCTTAGCTGGGG - Intergenic
1094612422 12:32007085-32007107 AGGCAGCCCCTTGGCAGCTCTGG - Intergenic
1095953358 12:47793533-47793555 CGGCTCCCCCGGGGCAGCACCGG - Exonic
1099365275 12:81759529-81759551 CGGCAGCCCGGGAGCGGCTCTGG - Intronic
1102278278 12:111599160-111599182 CGCCAGCCCGGGCGCCCCTCCGG - Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103930067 12:124445327-124445349 CGGCTGCCCCGGCCCCGCCCCGG + Intronic
1104707547 12:130958641-130958663 CGCCTGCCCCCGGGCAGCTCTGG + Intronic
1104910842 12:132240297-132240319 CTGTAGCCCCGGCCCGGCTCTGG + Intronic
1105277241 13:18943425-18943447 CGGAAGCCCCTGCGCAGGGCCGG - Intergenic
1105302834 13:19151137-19151159 CGGCAGCTCCAGCCCAGCTAGGG + Intergenic
1105578776 13:21675079-21675101 CGGAAGCCCCGGCCCAGGTTGGG + Intronic
1106208700 13:27621635-27621657 CGGGCGCCCCGGCTCAACTCTGG - Exonic
1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG + Intronic
1110250725 13:73377546-73377568 CGGCAGCCCCTTCCCATCTCAGG - Intergenic
1113517425 13:110914530-110914552 CGGCTGCCCCGCCGCGACTCCGG + Intronic
1113679543 13:112233588-112233610 CGGCAGCACCGGAGCAGGTGTGG - Intergenic
1114637389 14:24195579-24195601 CTGGAGGCCCGGCCCAGCTCCGG + Intronic
1115604153 14:34983262-34983284 GGGCAGCCCCAGCGCTGCTCAGG + Intronic
1117722178 14:58638418-58638440 CCGCACCCCCGGCGCCGCGCAGG - Exonic
1121183487 14:91947280-91947302 CGGGACCCCCGGAGGAGCTCGGG + Exonic
1122060558 14:99134128-99134150 CAGCAGCCCTGGAGTAGCTCAGG - Intergenic
1122263316 14:100535285-100535307 CGGCAGCCTTGGCCCAGATCTGG - Intergenic
1122615242 14:103013217-103013239 CAGGAGCCACGGGGCAGCTCAGG + Intronic
1122647964 14:103207462-103207484 CGGCAGCCCTGGCGGGGCGCGGG - Intergenic
1122657923 14:103274194-103274216 CAGCAGCCCCGCAGCAGCCCCGG + Intergenic
1122658558 14:103279196-103279218 CGGCAGCCCTGGCGGGGCGCGGG - Intergenic
1122719653 14:103715224-103715246 CGGGAGCCCCGCCGCAGCTCGGG - Intronic
1122786672 14:104167223-104167245 CGGCAGTCCCAGCCCAGCACAGG - Intronic
1123004619 14:105315187-105315209 CCGCCGCCCCCCCGCAGCTCCGG + Exonic
1124629198 15:31327442-31327464 CGCCCGCCCCGGCGGAGCGCAGG + Exonic
1125487933 15:40125236-40125258 CCTCAGCCCAGGCACAGCTCTGG - Intergenic
1126800894 15:52295649-52295671 CGGCAGCCCCGGCCTGGCCCCGG - Exonic
1129535580 15:76311356-76311378 CGGCGGCTCCGGGGCAGCTCCGG - Exonic
1130088509 15:80799299-80799321 AGGCAGTCCCTGCGCAGCACTGG + Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1130370872 15:83284546-83284568 CGGCAGCCCCGGCACCGCAGCGG - Exonic
1131261350 15:90889655-90889677 TGGGAGCCCCGCCGCAGCCCAGG - Intronic
1131367895 15:91854631-91854653 CTGCAGCCCCGGCTCAGGCCAGG - Intronic
1134105153 16:11480060-11480082 TGGCAGCCACTGCTCAGCTCTGG - Intronic
1136541565 16:30930286-30930308 CGGCCAGCCCGGGGCAGCTCTGG + Exonic
1136633010 16:31500159-31500181 CTGCAGCCCCAGCCCAGCTCAGG + Intronic
1139917986 16:70439666-70439688 CAGCGGCCCCACCGCAGCTCGGG - Intergenic
1139937880 16:70584295-70584317 AGGCAGCCCCTGGGAAGCTCAGG - Intronic
1141516607 16:84549105-84549127 TGGCTGCCCCGGGGCATCTCTGG - Intronic
1141954613 16:87362127-87362149 GGGCAGCCCCGGCCTAGATCTGG - Intronic
1142188456 16:88706079-88706101 CGGCCGCCCCGGTGCAGCTCCGG - Intronic
1142890246 17:2938484-2938506 AGCCAGCCCCGGCTCAGCCCAGG - Intronic
1143503515 17:7351936-7351958 CGACCGCCCCGCCGCCGCTCAGG - Intronic
1144586744 17:16491930-16491952 AGCCAGCCCCGGCGCCGCGCCGG - Exonic
1144862556 17:18314794-18314816 CGGCAGCCGGGGAGCGGCTCCGG - Exonic
1146055080 17:29576888-29576910 CAGGAGCCCCTGCGCAGCACCGG - Exonic
1147833792 17:43315599-43315621 CGGGAGCCCCAGCCCAGCTTCGG + Intergenic
1148340836 17:46872564-46872586 CGGCAGCCCCGGCACAGGGCGGG + Exonic
1148563468 17:48619513-48619535 CGGGAGCCCCGGCCCAGCTGCGG + Intronic
1148652587 17:49260479-49260501 CGGCAGCCCCAGCCCAACCCCGG + Intergenic
1148863666 17:50617767-50617789 CAGCAGCCCCAGCCCAGCCCTGG + Intronic
1150625051 17:66836101-66836123 AGGCAGCCCCGGGGCAGCCCTGG - Intronic
1150840263 17:68600641-68600663 AGGCGGTCCCGGCGCAGCCCCGG + Exonic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1151780140 17:76240252-76240274 CTGCAGCCCCGGCCCGGCCCCGG + Exonic
1152179215 17:78807382-78807404 AGGCAGCCCCTGAGCAGTTCTGG + Exonic
1152332643 17:79682026-79682048 GGGCAGCCCCAGGGCATCTCTGG - Intergenic
1152345335 17:79747679-79747701 CTGCAGCCCCCGCGCCGCTGCGG - Intergenic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152544197 17:80992436-80992458 CGGCAGCACCGCCGGGGCTCCGG - Intronic
1152563647 17:81090736-81090758 CCGCAGCCTCCCCGCAGCTCGGG - Intronic
1152751808 17:82065744-82065766 CGGCGGCCCCGGCGCGGTGCGGG - Intronic
1154032762 18:10767737-10767759 CCGCAGCCTTGGAGCAGCTCTGG - Intronic
1155926250 18:31658612-31658634 CTGCAGCCCCGGGGGAGCCCTGG + Intronic
1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG + Intronic
1160025043 18:75209567-75209589 CGCCGGCCGCCGCGCAGCTCCGG - Intergenic
1160171543 18:76559380-76559402 CTGCAGCCCCGTCGCTGCACCGG + Intergenic
1160855550 19:1215569-1215591 CTGCAGCCCTGGCAGAGCTCAGG + Intronic
1161384827 19:3985329-3985351 CGGAGGCCCCGCCGCCGCTCCGG + Intronic
1161615631 19:5268680-5268702 CAGCATCCCAGGCGCAGCGCAGG + Intronic
1161973332 19:7595984-7596006 CCGCAGCCCCGGCGCCGCCATGG + Exonic
1162046819 19:8005515-8005537 CGCCCGCCCCGGAGCAGCCCCGG - Exonic
1162128492 19:8511786-8511808 CGGCAGGCCCGGCGCTGATGCGG + Exonic
1162571992 19:11479582-11479604 CGGCAGCCCGGGCGTATCCCGGG - Intronic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1163517950 19:17776100-17776122 AGGCAGCAGCGGCACAGCTCAGG + Exonic
1163739541 19:19002799-19002821 CAGCACACCCGGCGCAGGTCTGG + Intronic
1164635382 19:29787681-29787703 CCGCAGCCCTGGAGCAGCCCAGG + Intergenic
1164984342 19:32637683-32637705 CAGCCGCCCAGCCGCAGCTCTGG + Intronic
1165448233 19:35868509-35868531 TGGCGGCGCCGGCGCAGCCCGGG + Exonic
1166292454 19:41871827-41871849 CTGCAGCCCAGGCCCAGCTGAGG - Exonic
1166310453 19:41959392-41959414 GCGCAGCCCCGGAGCAGCTGGGG + Intergenic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1168314127 19:55476710-55476732 CGGCAGCGGCGGTGCAGCTGTGG - Exonic
925174201 2:1770889-1770911 CGGCAGCCGCCGCTCAGCCCCGG + Intergenic
925463977 2:4089659-4089681 TCACAGCCCCGGGGCAGCTCTGG - Intergenic
927964934 2:27262700-27262722 CGGCCGCCCCAGCGCACCGCGGG - Intronic
932385903 2:71332224-71332246 CGGCAGGCCGGGCGCTGCTGGGG - Intronic
932422678 2:71610933-71610955 GGGCAGACCCGGAGCAGCTCAGG + Intronic
932804186 2:74768814-74768836 TGGCAGCCCCAGAGCAGCTTGGG - Intergenic
937218576 2:120328313-120328335 TGGGAGCCCCGGCGCTTCTCTGG - Intergenic
938551236 2:132384234-132384256 CAGCAGCTCAGGGGCAGCTCTGG + Intergenic
938583685 2:132669767-132669789 GGGCAGCCCCAGCGCAGGGCTGG + Intronic
942279352 2:174344266-174344288 AGGCGGCTCCGGGGCAGCTCGGG + Intergenic
942565975 2:177264841-177264863 CGTCAGCCCCGGCGCGGGTGGGG - Exonic
942748520 2:179263927-179263949 CAGGAGCCTCGGCGCAGCCCTGG + Intronic
945710025 2:213284239-213284261 CGAGAGCTCGGGCGCAGCTCTGG - Intergenic
946306641 2:218860125-218860147 CGGCTGTCCTGGCGCGGCTCTGG + Intronic
949035712 2:241814917-241814939 CAGCAGCCCTGGCGGAGCACCGG + Exonic
1168893411 20:1308453-1308475 CGGTGGCCCTGGCCCAGCTCTGG + Exonic
1172282838 20:33720184-33720206 TGGCAGCCCCGCCGCAGCTAAGG - Exonic
1173676219 20:44838018-44838040 TGGCAGCCCCGGTGCAGAGCAGG - Intergenic
1175847302 20:62065541-62065563 GGGCGGCTCCGGCGCCGCTCCGG + Exonic
1175997757 20:62819058-62819080 TGGCAGACCCGGCTCAGCTGGGG - Intronic
1176674838 21:9768272-9768294 CCTCAGCCCCGCCGAAGCTCAGG - Intergenic
1176674850 21:9768326-9768348 CCTCAGCCCCGCCGAAGCTCAGG - Intergenic
1176674874 21:9768434-9768456 CCTCAGCCCCGCCGAAGCTCAGG - Intergenic
1178488565 21:33033680-33033702 GGGCAGCCACGTTGCAGCTCTGG + Intergenic
1179524644 21:41967780-41967802 GGGCAGCCCCAGCCCAGCACTGG - Intergenic
1179617088 21:42589306-42589328 CGGCAGGCCCGGTGCAGGTAAGG - Intergenic
1179617325 21:42590326-42590348 CGGCAGGCCCGGTGCAGGTAAGG - Intergenic
1180037344 21:45256642-45256664 CCCCAGCCCGGGGGCAGCTCTGG - Intergenic
1180037538 21:45257499-45257521 CGGCAGCCCCAGGGCAGCCAGGG + Intergenic
1180736991 22:18024525-18024547 CTGCAGCCCCGGCGGAGTCCCGG - Exonic
1180917127 22:19497089-19497111 GGGCAGCCCGGGTGCAGCACTGG - Intronic
1180972797 22:19824378-19824400 CGGTGGCCCCGGCCCAGCCCCGG + Intronic
1182801966 22:33038884-33038906 CGGAAGCCCCGGGGCTGTTCTGG + Intronic
1183606881 22:38871418-38871440 CCCCAGCCCCGGCACAGCACGGG - Intronic
1184120907 22:42449578-42449600 ATGCAGCCCTGGCCCAGCTCAGG + Intergenic
1185062872 22:48616139-48616161 CACCAGCCCCGGGGCTGCTCAGG + Intronic
1185176520 22:49330420-49330442 CGGCAGCCCCGGTGCTGGTGAGG - Intergenic
1185301455 22:50083345-50083367 ACGCAGCCCCGCCGCAGCCCAGG + Intronic
950966686 3:17151676-17151698 CTCCAGCCCCAGAGCAGCTCAGG + Intergenic
953065285 3:39463896-39463918 CTGTAGACCCGGCGCAGCCCTGG - Intergenic
954395182 3:50289723-50289745 CGGCAGCCACGTAGCAGCCCAGG + Exonic
958779312 3:98522634-98522656 CGGCTGCCCCGCCCCAGCCCTGG - Intronic
960582747 3:119294689-119294711 CGGCGGCCCCGGAGCGGCGCGGG + Exonic
961559714 3:127720246-127720268 CAGCAGCCCCTGCCCAGCACTGG + Intronic
967205945 3:187121464-187121486 AGGCAGCTCAGGAGCAGCTCAGG + Intronic
968576793 4:1370378-1370400 GGGCAGCCCCTGCTCAGCGCTGG - Intronic
968965151 4:3765940-3765962 CGGCGGCGGCGGCGCAGCTCCGG + Intergenic
977607441 4:98996274-98996296 CCGCAGCACCGGCGGGGCTCGGG + Intronic
980866725 4:138561492-138561514 TGGCAGCCCAGACGTAGCTCTGG - Intergenic
982078276 4:151760951-151760973 CGGCAGCCCCAGCGCAGCATGGG + Exonic
983060409 4:163153264-163153286 CTGCAGCCCCGGTGCAGTGCGGG + Intronic
984095448 4:175427926-175427948 CGGCACTCCCCGCGCAGCCCTGG - Intergenic
984735098 4:183100118-183100140 CGGGAGCCCCTTCCCAGCTCGGG - Intronic
984944616 4:184961395-184961417 CAGCAGCCCCAGTGGAGCTCTGG + Intergenic
984973485 4:185210117-185210139 AGGCGGCCGCCGCGCAGCTCAGG - Intronic
984992753 4:185396762-185396784 TGGCAGCCGCGCCCCAGCTCCGG - Exonic
985674817 5:1225561-1225583 CGGCAAACCCAGTGCAGCTCAGG - Exonic
985749538 5:1666478-1666500 GGGCAGCCCAGGGGCAGCCCAGG - Intergenic
985828156 5:2207971-2207993 CGGAGGCCCCAGCACAGCTCTGG + Intergenic
987303337 5:16616727-16616749 CGGCAGCCCAGCCACAGCACCGG + Exonic
989229786 5:39073823-39073845 CGGCAGACCCGGCGACCCTCTGG - Intronic
990041563 5:51383435-51383457 CGGCAGACTCGGCGCGGCTCGGG - Exonic
991291130 5:65034984-65035006 CGGCAGCCCTGGGGCAGAACAGG - Intergenic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
995854405 5:116576585-116576607 CTGCAGCCCCTTCGAAGCTCCGG + Intergenic
998040812 5:138950042-138950064 CGGCAGCCTCGGGGCAGCCTTGG + Intronic
998130873 5:139650475-139650497 CGGCGGCCCTGGGGCGGCTCCGG - Intronic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
1002641303 5:180631875-180631897 CTGCAGGGCCGGAGCAGCTCAGG + Intronic
1003139057 6:3456443-3456465 CGGCGGCCTCGGCGCCCCTCGGG - Exonic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1006022408 6:31125210-31125232 CTGGAGCCCCAGAGCAGCTCTGG - Intronic
1006317673 6:33299780-33299802 AGGAAGCGGCGGCGCAGCTCAGG - Intronic
1011044372 6:83065812-83065834 CGGCAGCCCCGCTGCGGCGCAGG + Exonic
1013232132 6:108168582-108168604 CTCCAGCCCCGGCTCAGGTCGGG + Intronic
1014272492 6:119349660-119349682 CCGCAGCCCCGGCGCGGCTCAGG + Exonic
1018058972 6:160075391-160075413 GGGCAGTCCCGGGGCAGCACTGG + Intronic
1020139876 7:5606371-5606393 CGGCAGCCCAGGCCCAGGGCTGG - Exonic
1022721196 7:32943024-32943046 CGGCACCTGCGGCGCGGCTCTGG + Intergenic
1024213469 7:47227285-47227307 AGGCAGCCCAGCAGCAGCTCTGG - Intergenic
1025678875 7:63665823-63665845 TGGCAGCCCCAGACCAGCTCAGG + Intergenic
1025777791 7:64574483-64574505 AGGCAGGCCTGGCTCAGCTCAGG + Intergenic
1026598211 7:71752214-71752236 TGGCGGCCCCGGCTCGGCTCGGG + Intergenic
1026889828 7:73975263-73975285 CGGCAGACCGGGGGCTGCTCCGG - Intergenic
1027111397 7:75442623-75442645 CGGCCGGCCCGCCGCAGCCCCGG + Intronic
1027269707 7:76512827-76512849 CAGCATCCCCGGCCCAGGTCTGG + Intronic
1027320419 7:77006722-77006744 CAGCATCCCCGGCCCAGGTCTGG + Intergenic
1029073333 7:97917527-97917549 CTGCAGCCCCGGCTGAGCTGGGG - Intergenic
1029670669 7:102028481-102028503 TGGCAGCCCCAGACCAGCTCAGG - Intronic
1030055893 7:105583329-105583351 CGGCAGCGGCGGGGCTGCTCAGG + Intronic
1030227587 7:107169519-107169541 GGGCAGCCCCGGCGCTGCGTCGG - Intronic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1031919005 7:127588161-127588183 CGGCAGCCCGAGCGCGGCTGAGG - Intronic
1031972533 7:128074895-128074917 TGGCAGCCCAGGCCCACCTCAGG - Intronic
1031986556 7:128167733-128167755 CGGGAGCCCCGGCTAAGCCCGGG + Intergenic
1034400084 7:150856479-150856501 TGGCAGCCACGGCCCAGCCCAGG - Exonic
1035399813 7:158557386-158557408 AGGCAGCTCCCGCGCAGGTCAGG + Intronic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1036234806 8:7029381-7029403 CTGCAGCCCAGGAGCAGCTTGGG - Intergenic
1036244356 8:7103763-7103785 CTGCAGCCCCGGCTTAGCTGGGG + Intergenic
1037336839 8:17800887-17800909 CGGCAGCGCCGGCGGAGCGGAGG - Intronic
1037893318 8:22635714-22635736 CAGCACTCCCTGCGCAGCTCTGG - Intronic
1040423405 8:47260953-47260975 CGGCTGCCGCGGGGCATCTCCGG - Exonic
1040884231 8:52242401-52242423 AAGCAGCCCCGGCGCATCACAGG + Intronic
1044824044 8:96179513-96179535 CTGCAGCACCGCAGCAGCTCTGG - Intergenic
1049182198 8:141228738-141228760 CTGCAGCCCTGGCTAAGCTCAGG + Intronic
1050880006 9:10687938-10687960 AGGCAGCCCCGGGAGAGCTCAGG + Intergenic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1055321613 9:75088263-75088285 CGCGCGCCCCTGCGCAGCTCCGG + Intergenic
1055574672 9:77648765-77648787 CGGACGCCCCGGCCCAGCTCGGG + Intergenic
1056333232 9:85539302-85539324 CGGCAGCCCCGGCAATGCTCAGG + Intergenic
1057328065 9:94084633-94084655 CAGCAGGCCCGGCGGGGCTCTGG + Exonic
1060474593 9:123977192-123977214 CGGCAGCCGCGGTGCAGCAGAGG + Intergenic
1060476769 9:123992931-123992953 CGGCAGCCGCGGTGCAGCAGAGG - Intergenic
1061288053 9:129635455-129635477 TGCCAGCCCCGGCTCATCTCAGG - Exonic
1061899197 9:133664359-133664381 CCCCAGCCTCGGCGCTGCTCTGG - Intronic
1061901132 9:133672644-133672666 GGTCAGCCCCGGCCCAGCACCGG + Intronic
1061906635 9:133702570-133702592 TGCCAGCCTCGGCGCAGCTCCGG + Intronic
1062102789 9:134737301-134737323 GGGCAGCTCTGGCTCAGCTCTGG - Intronic
1062381945 9:136290883-136290905 CAGCGGCCCTGGAGCAGCTCCGG - Exonic
1203773530 EBV:61000-61022 CGGCGGGCCCGGGTCAGCTCGGG + Intergenic
1186485586 X:9932287-9932309 CGGCCCTCCCGGGGCAGCTCTGG - Exonic
1186517711 X:10178739-10178761 CGACAGCCCAGGCTCAGCTATGG - Intronic
1187445827 X:19360013-19360035 CTGCAGCACCAGCGCTGCTCGGG - Exonic
1190711218 X:53072025-53072047 CTGCAGCCCGGGCCCAGCTGAGG - Intronic
1191141727 X:57121650-57121672 CTGTAGCCCCGGCGGAGCTATGG + Intergenic
1191250556 X:58258153-58258175 CAGCAGCCCCTGCGCAGGGCTGG + Intergenic
1191253115 X:58268615-58268637 CAGCAGCCCCTGCGCCGCACCGG - Intergenic
1192584563 X:72308947-72308969 CGTCAGCCCCGGCTTGGCTCGGG + Intergenic
1195668349 X:107449915-107449937 CGGCAGCGGCGGCGCAGCGGCGG - Intergenic
1195716918 X:107826599-107826621 CGGGGGCCCCAGCTCAGCTCCGG + Intronic
1201274936 Y:12287854-12287876 CTGCACCCCCGACTCAGCTCCGG - Intergenic