ID: 992105871

View in Genome Browser
Species Human (GRCh38)
Location 5:73448495-73448517
Sequence CGGCAGCCCCGGCGCAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992105871_992105880 28 Left 992105871 5:73448495-73448517 CCGGAGCTGCGCCGGGGCTGCCG 0: 1
1: 0
2: 3
3: 20
4: 256
Right 992105880 5:73448546-73448568 TTATAACTCCTGCGCCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992105871 Original CRISPR CGGCAGCCCCGGCGCAGCTC CGG (reversed) Intergenic