ID: 992105871 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:73448495-73448517 |
Sequence | CGGCAGCCCCGGCGCAGCTC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 280 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 20, 4: 256} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
992105871_992105880 | 28 | Left | 992105871 | 5:73448495-73448517 | CCGGAGCTGCGCCGGGGCTGCCG | 0: 1 1: 0 2: 3 3: 20 4: 256 |
||
Right | 992105880 | 5:73448546-73448568 | TTATAACTCCTGCGCCGCCGCGG | 0: 1 1: 0 2: 0 3: 1 4: 7 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
992105871 | Original CRISPR | CGGCAGCCCCGGCGCAGCTC CGG (reversed) | Intergenic | ||