ID: 992105880

View in Genome Browser
Species Human (GRCh38)
Location 5:73448546-73448568
Sequence TTATAACTCCTGCGCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992105876_992105880 17 Left 992105876 5:73448506-73448528 CCGGGGCTGCCGGGTGGCGGCGG 0: 1
1: 1
2: 2
3: 77
4: 408
Right 992105880 5:73448546-73448568 TTATAACTCCTGCGCCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 7
992105878_992105880 8 Left 992105878 5:73448515-73448537 CCGGGTGGCGGCGGAGTCTCGCG 0: 1
1: 1
2: 0
3: 5
4: 65
Right 992105880 5:73448546-73448568 TTATAACTCCTGCGCCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 7
992105871_992105880 28 Left 992105871 5:73448495-73448517 CCGGAGCTGCGCCGGGGCTGCCG 0: 1
1: 0
2: 3
3: 20
4: 256
Right 992105880 5:73448546-73448568 TTATAACTCCTGCGCCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992105880 Original CRISPR TTATAACTCCTGCGCCGCCG CGG Intergenic