ID: 992106400

View in Genome Browser
Species Human (GRCh38)
Location 5:73451826-73451848
Sequence CAGCCTTCATCCCCCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992106400_992106404 -10 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106404 5:73451839-73451861 ATGAAGGCTGGAAGAGACCTGGG 0: 1
1: 0
2: 5
3: 37
4: 287
992106400_992106407 5 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106407 5:73451854-73451876 GACCTGGGGGCTCAGACTTACGG 0: 1
1: 0
2: 2
3: 16
4: 141
992106400_992106408 6 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106408 5:73451855-73451877 ACCTGGGGGCTCAGACTTACGGG 0: 1
1: 0
2: 0
3: 7
4: 133
992106400_992106411 11 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106411 5:73451860-73451882 GGGGCTCAGACTTACGGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 136
992106400_992106406 -8 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106406 5:73451841-73451863 GAAGGCTGGAAGAGACCTGGGGG 0: 1
1: 0
2: 4
3: 23
4: 374
992106400_992106412 19 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106412 5:73451868-73451890 GACTTACGGGGAAGGAACCTAGG 0: 1
1: 0
2: 1
3: 7
4: 91
992106400_992106405 -9 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106405 5:73451840-73451862 TGAAGGCTGGAAGAGACCTGGGG 0: 1
1: 0
2: 3
3: 35
4: 343
992106400_992106410 7 Left 992106400 5:73451826-73451848 CCTCCTTAGGGGGATGAAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 992106410 5:73451856-73451878 CCTGGGGGCTCAGACTTACGGGG 0: 1
1: 0
2: 1
3: 12
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992106400 Original CRISPR CAGCCTTCATCCCCCTAAGG AGG (reversed) Intergenic
901052469 1:6432236-6432258 CAGCCTCCAGCCTTCTAAGGGGG - Intronic
903601547 1:24545592-24545614 CAGGCTCCTTCCCCCAAAGGAGG + Intergenic
903685634 1:25129672-25129694 CAGCCTCCATCTCGTTAAGGTGG + Intergenic
908006450 1:59733785-59733807 CACTCTGCATCCCCCTAAGTGGG + Intronic
915203947 1:154255253-154255275 CAGCATTCATCCTCCTTGGGTGG + Exonic
915300926 1:154951231-154951253 CTGCCTTCAACCCCCAAAGCAGG - Exonic
920665228 1:207958813-207958835 CAGCCTTAATCGCAGTAAGGGGG + Intergenic
920946730 1:210536254-210536276 CATCCTTCATCCACCTAACCTGG + Intronic
922802755 1:228371731-228371753 CTGCCTTCAGCCCCCTCCGGGGG + Exonic
923339451 1:232995254-232995276 AACCCTCCATCCCCCTAAGCAGG + Intronic
1065808681 10:29420864-29420886 CAGCGTTCATCCATCTATGGAGG - Intergenic
1067015815 10:42755618-42755640 CGGCCTTCCTCCCCAAAAGGTGG - Intergenic
1072202735 10:93175843-93175865 CAGCCATCATTCCCCTGAAGTGG - Intergenic
1073111515 10:101065741-101065763 CAGCCTCCCTCCCTCAAAGGCGG - Intronic
1074165766 10:110872353-110872375 CAGCCCTCCTCCCCCTCTGGCGG + Intronic
1076637255 10:131890148-131890170 CACCCTTCTTCACCCTCAGGTGG + Intergenic
1079083456 11:17429452-17429474 CAGCCTCCCTCCCCCACAGGCGG + Intronic
1081310719 11:41568585-41568607 CTGCCTTCAGCTCCCTGAGGAGG - Intergenic
1083593007 11:63906254-63906276 CAGTCTTCATCCCTTTAAGATGG - Intronic
1085326996 11:75613823-75613845 CAGCCTTCAACCCCCTACTAAGG + Intronic
1090408395 11:126491222-126491244 CAGCCTTCCTGACCCTCAGGTGG - Intronic
1103902142 12:124308853-124308875 CAGCCTGCGTCCCCCTAGGGTGG + Intronic
1104264713 12:127220600-127220622 CAGTATTCCTACCCCTAAGGTGG + Intergenic
1104442005 12:128801166-128801188 CAGCCTTCAGCCTCCTAAGCAGG + Intronic
1104954971 12:132459881-132459903 CACCTTTCAGCCCCCTAAGCTGG + Intergenic
1114080017 14:19195650-19195672 CAGCCTTCATCCCCATAACAAGG - Intergenic
1115665974 14:35547444-35547466 CAGCCTTTATCAATCTAAGGGGG + Intronic
1122758976 14:104006322-104006344 CATACTTCTTCCCCTTAAGGTGG - Intronic
1133160583 16:3909067-3909089 CAGCCCTCTTCCCCCGAAGCAGG + Intergenic
1134281291 16:12819453-12819475 CTGCCTTCATCCCCTTAATGTGG + Intergenic
1134776684 16:16859432-16859454 CAGTGTTCATCCCCTAAAGGTGG + Intergenic
1136171338 16:28491642-28491664 CAGCTCTCATTCCCCTCAGGTGG + Intronic
1141951638 16:87343651-87343673 CAGCCTTCCTCTCCATCAGGTGG + Exonic
1141994924 16:87630268-87630290 CAGACACCATCCCCCTAGGGTGG - Intronic
1147177898 17:38668147-38668169 CAGCCTTGATCTCCCTGAAGTGG + Intergenic
1148085283 17:44990213-44990235 CACCCTCCATCCCACTCAGGGGG - Intergenic
1148338938 17:46861677-46861699 CAGCCTTCATCTCTCCAATGAGG - Intronic
1148645480 17:49217672-49217694 CAGCACCCTTCCCCCTAAGGAGG - Intronic
1161657340 19:5524386-5524408 CAAACTGCATCCCCCTAACGAGG - Intergenic
1163440917 19:17322228-17322250 CAGCCCTCAGACCCCAAAGGAGG - Exonic
1164589842 19:29500708-29500730 CAGCCTTCATCACCCTAGGGAGG - Intergenic
1168152378 19:54456024-54456046 CAGCCTTCACCCTCCTAGAGGGG + Exonic
927646218 2:24878675-24878697 CAGCCTTCTCCCACCCAAGGAGG + Intronic
948488276 2:238295008-238295030 GAGCCTTCACCCTCCCAAGGAGG - Intergenic
1168998111 20:2147535-2147557 CAGGCTGCCACCCCCTAAGGAGG + Exonic
1171990334 20:31691255-31691277 CAGCCTTTAACACCCTATGGAGG + Intronic
1172130789 20:32653343-32653365 CAGCCTTCCCTCCCCTAGGGTGG - Intergenic
1173376350 20:42487065-42487087 CAGGCTTGATCCCCCGAGGGAGG + Intronic
1179767112 21:43582261-43582283 AGGCCTTCATCCCCCTCAGCAGG - Intronic
1179968355 21:44819229-44819251 CAGCCTTCCCCCTCCTAAGTGGG - Intergenic
1179982622 21:44904195-44904217 CAGCCTTCAGCCCCCCTGGGCGG + Intronic
1180500754 22:15927050-15927072 GAGCCTTCATCCCCATAACAAGG + Intergenic
1181466774 22:23114653-23114675 CAGCCCTCAGCCCCCTCACGAGG + Intronic
1183224468 22:36540007-36540029 CAGAGTTCATACCCCTAAGATGG - Intergenic
1184296632 22:43529221-43529243 CAGCCTTCAGCCCCTCAGGGAGG - Intronic
1184666270 22:45990741-45990763 CAGCCGTCACCCCCTTCAGGTGG + Intergenic
1185292891 22:50035943-50035965 CAGCCTTCTCCCCCCAAAGCAGG - Intronic
950495018 3:13328540-13328562 CAGGCATCAGCCCCCAAAGGAGG - Intronic
951564631 3:24001084-24001106 CTGCCTTCCTCCCACTAAGGTGG - Intergenic
956653084 3:71523125-71523147 CTGCCTTCATCTCCCTGTGGTGG - Intronic
959274024 3:104254431-104254453 CAGACTTCAACCCCCTGAGAAGG + Intergenic
960456720 3:117881494-117881516 CTGCCTCCATTCCCCTTAGGTGG + Intergenic
964880725 3:161419766-161419788 CTGCCTTGATCCCCACAAGGGGG - Intergenic
978965512 4:114735925-114735947 CAGACTTCTTCCCCTTCAGGGGG - Intergenic
984054385 4:174908825-174908847 CAGTCTTCAGCCACCTAAGAAGG + Intronic
990215843 5:53530912-53530934 CATCCTTCATCCCCAAATGGAGG - Intergenic
992106400 5:73451826-73451848 CAGCCTTCATCCCCCTAAGGAGG - Intergenic
992183698 5:74222908-74222930 CAAAATGCATCCCCCTAAGGTGG - Intergenic
992487767 5:77211543-77211565 CAGCCTTCCTGCCCTCAAGGAGG - Intronic
996110150 5:119555839-119555861 CAGCCTCTAGCTCCCTAAGGTGG - Intronic
997529363 5:134572504-134572526 CAGCCTTCATGTCCTTAAGCTGG - Intronic
1001145672 5:169182143-169182165 CAGGCTTCATCACCATAAGTAGG + Intronic
1001492276 5:172164338-172164360 AAGCCATCCTGCCCCTAAGGGGG + Intronic
1006188225 6:32192225-32192247 CAGCCTTCCTCATCCTGAGGGGG + Exonic
1007274009 6:40660442-40660464 CTGCTTTCATCCCCCTAATTAGG + Intergenic
1007357892 6:41334200-41334222 CCGCCTTCCTCCCCCTCGGGAGG + Intergenic
1014318300 6:119894206-119894228 CAGGCTTCATTCTCCTTAGGTGG - Intergenic
1016980638 6:149850882-149850904 CAGTCTTCATCCACCAAATGGGG + Intronic
1018653317 6:166008828-166008850 CTCCCTTCGTCCCCTTAAGGAGG + Intergenic
1020927715 7:14353474-14353496 CAGCCTTCTTGCCCCTATGAAGG + Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022019572 7:26385348-26385370 CAACCTTCATCCCCACAAGGGGG + Intergenic
1022603528 7:31785230-31785252 CAGCATTCACCCCACAAAGGGGG + Intronic
1022999516 7:35793579-35793601 CAAACTTCATCCCACAAAGGAGG - Intergenic
1024582627 7:50812438-50812460 ATGCCTCCATCTCCCTAAGGGGG - Intergenic
1025708958 7:63890609-63890631 CAGGCTTCTTCCCCCTCAGCTGG + Intergenic
1026712234 7:72752221-72752243 CAGCCTGCAGCCCCCTCAAGTGG - Intronic
1029111983 7:98217334-98217356 CAGCCTTGATCCCCCAAACTGGG + Exonic
1029595164 7:101533793-101533815 CTGGCTTCATCGCCCTAAGGTGG - Intronic
1031124604 7:117758933-117758955 CAGCCTTCATTCAGCTAATGTGG - Intronic
1031134501 7:117871906-117871928 GTGCCTTCATCCCCAAAAGGTGG - Intronic
1031634487 7:124085342-124085364 CAGCCTTCAACTCTCTAATGTGG - Intergenic
1031724183 7:125216244-125216266 CAGCCTCCATGCCAGTAAGGTGG - Intergenic
1035417802 7:158704604-158704626 CAGCCTCCCCTCCCCTAAGGAGG - Intronic
1035453840 7:158996631-158996653 CAGCCTGCATCCAACAAAGGAGG - Intergenic
1036668866 8:10766464-10766486 CACCCTTTCTCCCCCAAAGGTGG + Intronic
1037176505 8:15952382-15952404 CAGCCTTCATCACAATCAGGAGG + Intergenic
1037271626 8:17136661-17136683 CAGTCTTCATCCCCCAACAGCGG + Intergenic
1037806057 8:22058431-22058453 CATCCTGCAGCCCCCTCAGGCGG - Intronic
1046850225 8:118963930-118963952 CAACATGCATCCCCCCAAGGAGG - Intergenic
1048646570 8:136427720-136427742 CAGCCAACATCCACATAAGGAGG + Intergenic
1052679369 9:31669272-31669294 CAGCTTTCTTCTCCCTAAGAAGG - Intergenic
1056652521 9:88479493-88479515 CAGCCTTCTTCCACCTAAGCCGG - Intergenic
1057759903 9:97863571-97863593 CAGCCCTCCTCCCCGAAAGGAGG - Intergenic
1057903566 9:98967474-98967496 CAGCCTTCTTCCCCCACAGCTGG + Intronic
1059639774 9:116205153-116205175 AAGCCTCCATTTCCCTAAGGGGG - Intronic
1060411277 9:123402036-123402058 CAAATTTCATCCCCTTAAGGAGG + Intronic
1060980337 9:127788216-127788238 CAGCCTTCATGTCCCTATGCAGG - Exonic
1061828139 9:133274680-133274702 CAGCCTCCATACCCCAAACGCGG - Intronic
1191692671 X:63957158-63957180 CAGCCTTCATTCCACAAATGTGG + Intergenic
1197268092 X:124397443-124397465 CAGCCTTCTCCTCCTTAAGGAGG - Intronic
1198258968 X:134949541-134949563 CAGCCTTCATTCCCTTGTGGAGG - Intergenic
1199673471 X:150165752-150165774 CAGCCTTCATCCCCACATAGAGG + Intergenic
1200011019 X:153120971-153120993 CAGCCTTCATTCCGCTAAGTGGG - Intergenic
1200028580 X:153278951-153278973 CAGCCTTCATTCCGCTAAGTGGG + Intergenic
1201577733 Y:15478623-15478645 CAGCCTTCACCTCCCCCAGGAGG - Intergenic