ID: 992107366

View in Genome Browser
Species Human (GRCh38)
Location 5:73461011-73461033
Sequence TCCTCCTTCTTACCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992107361_992107366 -8 Left 992107361 5:73460996-73461018 CCTTTCCCAAAGCAGTCCTCCTT No data
Right 992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG No data
992107360_992107366 -7 Left 992107360 5:73460995-73461017 CCCTTTCCCAAAGCAGTCCTCCT No data
Right 992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992107366 Original CRISPR TCCTCCTTCTTACCTGGGAC TGG Intergenic
No off target data available for this crispr