ID: 992109786

View in Genome Browser
Species Human (GRCh38)
Location 5:73482080-73482102
Sequence CTGGGCAATGACAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992109781_992109786 -6 Left 992109781 5:73482063-73482085 CCTTGTTCATGAGCCCACTGGGC No data
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data
992109774_992109786 18 Left 992109774 5:73482039-73482061 CCTCCATCCCTGCCATTACGGTC No data
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data
992109775_992109786 15 Left 992109775 5:73482042-73482064 CCATCCCTGCCATTACGGTCACC No data
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data
992109776_992109786 11 Left 992109776 5:73482046-73482068 CCCTGCCATTACGGTCACCTTGT No data
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data
992109778_992109786 6 Left 992109778 5:73482051-73482073 CCATTACGGTCACCTTGTTCATG No data
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data
992109772_992109786 29 Left 992109772 5:73482028-73482050 CCTATGCATAACCTCCATCCCTG 0: 83
1: 170
2: 211
3: 234
4: 320
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data
992109777_992109786 10 Left 992109777 5:73482047-73482069 CCTGCCATTACGGTCACCTTGTT No data
Right 992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992109786 Original CRISPR CTGGGCAATGACAAGGTGGC TGG Intergenic
No off target data available for this crispr