ID: 992110306 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:73486611-73486633 |
| Sequence | GCTACTTGTAAGGCCAAAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 992110306_992110310 | 17 | Left | 992110306 | 5:73486611-73486633 | CCTGCTTTGGCCTTACAAGTAGC | No data | ||
| Right | 992110310 | 5:73486651-73486673 | AAACCAAAAATAAAATTCTAAGG | 0: 117 1: 172 2: 160 3: 261 4: 1940 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 992110306 | Original CRISPR | GCTACTTGTAAGGCCAAAGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||