ID: 992110306

View in Genome Browser
Species Human (GRCh38)
Location 5:73486611-73486633
Sequence GCTACTTGTAAGGCCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992110306_992110310 17 Left 992110306 5:73486611-73486633 CCTGCTTTGGCCTTACAAGTAGC No data
Right 992110310 5:73486651-73486673 AAACCAAAAATAAAATTCTAAGG 0: 117
1: 172
2: 160
3: 261
4: 1940

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992110306 Original CRISPR GCTACTTGTAAGGCCAAAGC AGG (reversed) Intergenic
No off target data available for this crispr