ID: 992110883

View in Genome Browser
Species Human (GRCh38)
Location 5:73492327-73492349
Sequence TCTTCAGCCGTAAGGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992110883_992110890 12 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110890 5:73492362-73492384 TTGCTCCACATGTTGGTTCTGGG No data
992110883_992110894 27 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110894 5:73492377-73492399 GTTCTGGGGTCCATACTCAAGGG No data
992110883_992110888 5 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110888 5:73492355-73492377 TTTAGGATTGCTCCACATGTTGG No data
992110883_992110889 11 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110889 5:73492361-73492383 ATTGCTCCACATGTTGGTTCTGG No data
992110883_992110893 26 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110893 5:73492376-73492398 GGTTCTGGGGTCCATACTCAAGG No data
992110883_992110891 13 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110891 5:73492363-73492385 TGCTCCACATGTTGGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992110883 Original CRISPR TCTTCAGCCGTAAGGCCACG TGG (reversed) Intergenic