ID: 992110886

View in Genome Browser
Species Human (GRCh38)
Location 5:73492335-73492357
Sequence AAACCCTATCTTCAGCCGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992110886_992110895 26 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110895 5:73492384-73492406 GGTCCATACTCAAGGGTCTATGG No data
992110886_992110888 -3 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110888 5:73492355-73492377 TTTAGGATTGCTCCACATGTTGG No data
992110886_992110890 4 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110890 5:73492362-73492384 TTGCTCCACATGTTGGTTCTGGG No data
992110886_992110893 18 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110893 5:73492376-73492398 GGTTCTGGGGTCCATACTCAAGG No data
992110886_992110894 19 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110894 5:73492377-73492399 GTTCTGGGGTCCATACTCAAGGG No data
992110886_992110891 5 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110891 5:73492363-73492385 TGCTCCACATGTTGGTTCTGGGG No data
992110886_992110889 3 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110889 5:73492361-73492383 ATTGCTCCACATGTTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992110886 Original CRISPR AAACCCTATCTTCAGCCGTA AGG (reversed) Intergenic
No off target data available for this crispr