ID: 992110888 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:73492355-73492377 |
Sequence | TTTAGGATTGCTCCACATGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
992110883_992110888 | 5 | Left | 992110883 | 5:73492327-73492349 | CCACGTGGCCTTACGGCTGAAGA | No data | ||
Right | 992110888 | 5:73492355-73492377 | TTTAGGATTGCTCCACATGTTGG | No data | ||||
992110886_992110888 | -3 | Left | 992110886 | 5:73492335-73492357 | CCTTACGGCTGAAGATAGGGTTT | No data | ||
Right | 992110888 | 5:73492355-73492377 | TTTAGGATTGCTCCACATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
992110888 | Original CRISPR | TTTAGGATTGCTCCACATGT TGG | Intergenic | ||