ID: 992110889

View in Genome Browser
Species Human (GRCh38)
Location 5:73492361-73492383
Sequence ATTGCTCCACATGTTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992110886_992110889 3 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110889 5:73492361-73492383 ATTGCTCCACATGTTGGTTCTGG No data
992110883_992110889 11 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110889 5:73492361-73492383 ATTGCTCCACATGTTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992110889 Original CRISPR ATTGCTCCACATGTTGGTTC TGG Intergenic
No off target data available for this crispr