ID: 992110892 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:73492367-73492389 |
| Sequence | TGGACCCCAGAACCAACATG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 992110892_992110897 | 4 | Left | 992110892 | 5:73492367-73492389 | CCACATGTTGGTTCTGGGGTCCA | No data | ||
| Right | 992110897 | 5:73492394-73492416 | CAAGGGTCTATGGCTACCTGAGG | No data | ||||
| 992110892_992110895 | -6 | Left | 992110892 | 5:73492367-73492389 | CCACATGTTGGTTCTGGGGTCCA | No data | ||
| Right | 992110895 | 5:73492384-73492406 | GGTCCATACTCAAGGGTCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 992110892 | Original CRISPR | TGGACCCCAGAACCAACATG TGG (reversed) | Intergenic | ||