ID: 992110893 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:73492376-73492398 |
| Sequence | GGTTCTGGGGTCCATACTCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 992110886_992110893 | 18 | Left | 992110886 | 5:73492335-73492357 | CCTTACGGCTGAAGATAGGGTTT | No data | ||
| Right | 992110893 | 5:73492376-73492398 | GGTTCTGGGGTCCATACTCAAGG | No data | ||||
| 992110883_992110893 | 26 | Left | 992110883 | 5:73492327-73492349 | CCACGTGGCCTTACGGCTGAAGA | 0: 1 1: 0 2: 0 3: 1 4: 37 |
||
| Right | 992110893 | 5:73492376-73492398 | GGTTCTGGGGTCCATACTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 992110893 | Original CRISPR | GGTTCTGGGGTCCATACTCA AGG | Intergenic | ||