ID: 992110893

View in Genome Browser
Species Human (GRCh38)
Location 5:73492376-73492398
Sequence GGTTCTGGGGTCCATACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992110886_992110893 18 Left 992110886 5:73492335-73492357 CCTTACGGCTGAAGATAGGGTTT No data
Right 992110893 5:73492376-73492398 GGTTCTGGGGTCCATACTCAAGG No data
992110883_992110893 26 Left 992110883 5:73492327-73492349 CCACGTGGCCTTACGGCTGAAGA No data
Right 992110893 5:73492376-73492398 GGTTCTGGGGTCCATACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992110893 Original CRISPR GGTTCTGGGGTCCATACTCA AGG Intergenic
No off target data available for this crispr