ID: 992120865

View in Genome Browser
Species Human (GRCh38)
Location 5:73590684-73590706
Sequence GCATTACCACACAAAGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992120865_992120871 26 Left 992120865 5:73590684-73590706 CCAAAGTCTTTGTGTGGTAATGC No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data
992120865_992120869 9 Left 992120865 5:73590684-73590706 CCAAAGTCTTTGTGTGGTAATGC No data
Right 992120869 5:73590716-73590738 GCTGCTCATCTTCATCTACAAGG No data
992120865_992120870 10 Left 992120865 5:73590684-73590706 CCAAAGTCTTTGTGTGGTAATGC No data
Right 992120870 5:73590717-73590739 CTGCTCATCTTCATCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992120865 Original CRISPR GCATTACCACACAAAGACTT TGG (reversed) Intergenic
No off target data available for this crispr