ID: 992120870

View in Genome Browser
Species Human (GRCh38)
Location 5:73590717-73590739
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992120863_992120870 12 Left 992120863 5:73590682-73590704 CCCCAAAGTCTTTGTGTGGTAAT No data
Right 992120870 5:73590717-73590739 CTGCTCATCTTCATCTACAAGGG No data
992120862_992120870 15 Left 992120862 5:73590679-73590701 CCACCCCAAAGTCTTTGTGTGGT No data
Right 992120870 5:73590717-73590739 CTGCTCATCTTCATCTACAAGGG No data
992120865_992120870 10 Left 992120865 5:73590684-73590706 CCAAAGTCTTTGTGTGGTAATGC No data
Right 992120870 5:73590717-73590739 CTGCTCATCTTCATCTACAAGGG No data
992120864_992120870 11 Left 992120864 5:73590683-73590705 CCCAAAGTCTTTGTGTGGTAATG No data
Right 992120870 5:73590717-73590739 CTGCTCATCTTCATCTACAAGGG No data
992120860_992120870 16 Left 992120860 5:73590678-73590700 CCCACCCCAAAGTCTTTGTGTGG No data
Right 992120870 5:73590717-73590739 CTGCTCATCTTCATCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr