ID: 992120871

View in Genome Browser
Species Human (GRCh38)
Location 5:73590733-73590755
Sequence ACAAGGGATGCTGTCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992120863_992120871 28 Left 992120863 5:73590682-73590704 CCCCAAAGTCTTTGTGTGGTAAT No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data
992120866_992120871 4 Left 992120866 5:73590706-73590728 CCTCATCCCTGCTGCTCATCTTC No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data
992120864_992120871 27 Left 992120864 5:73590683-73590705 CCCAAAGTCTTTGTGTGGTAATG No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data
992120868_992120871 -3 Left 992120868 5:73590713-73590735 CCTGCTGCTCATCTTCATCTACA No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data
992120867_992120871 -2 Left 992120867 5:73590712-73590734 CCCTGCTGCTCATCTTCATCTAC No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data
992120865_992120871 26 Left 992120865 5:73590684-73590706 CCAAAGTCTTTGTGTGGTAATGC No data
Right 992120871 5:73590733-73590755 ACAAGGGATGCTGTCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992120871 Original CRISPR ACAAGGGATGCTGTCCACCC TGG Intergenic
No off target data available for this crispr