ID: 992121549

View in Genome Browser
Species Human (GRCh38)
Location 5:73598731-73598753
Sequence TGAGTTTGGAACTAACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992121546_992121549 14 Left 992121546 5:73598694-73598716 CCAATCTAAGGACTATAGTTTGA No data
Right 992121549 5:73598731-73598753 TGAGTTTGGAACTAACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992121549 Original CRISPR TGAGTTTGGAACTAACAGAC AGG Intergenic
No off target data available for this crispr