ID: 992124995

View in Genome Browser
Species Human (GRCh38)
Location 5:73630849-73630871
Sequence CTTGGTCAACACTACTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992124995 Original CRISPR CTTGGTCAACACTACTGGAA AGG Intronic
907403031 1:54237209-54237231 CAGGGTCAGCACTACTGTAAAGG + Intronic
907714072 1:56911556-56911578 CTTGGTTTTCACAACTGGAAGGG + Intronic
908435726 1:64103941-64103963 TTTGGTTATCACAACTGGAAAGG + Intronic
916415732 1:164590257-164590279 CTTGGCCAGCGCAACTGGAAAGG + Intronic
917275868 1:173331343-173331365 CTTGGAAAACACCACTGGGAAGG + Intergenic
922691025 1:227691198-227691220 CTAGGTCTACACTACAGGATTGG + Intergenic
922873267 1:228920276-228920298 CTTGGCCAGCAGCACTGGAAGGG - Intergenic
923814160 1:237357009-237357031 GTTGGAAAACACTACTGAAAGGG - Intronic
1063538406 10:6908147-6908169 CTTGGTAAACACTCCTGGCAAGG - Intergenic
1063938628 10:11105468-11105490 CATGGCCAACTCTTCTGGAAGGG - Intronic
1074086474 10:110211630-110211652 CTTGGTGAACACTACCAGTACGG - Intronic
1074349234 10:112718667-112718689 CTTGGTCAACACTATTTGCTTGG - Intronic
1076047272 10:127304260-127304282 CTAGGGTAACACTCCTGGAATGG - Intronic
1080665886 11:34335994-34336016 ATTGGCCAACTCTACTGGAGGGG + Intronic
1082296484 11:50446335-50446357 AATGGTGACCACTACTGGAATGG + Intergenic
1084346989 11:68559633-68559655 TTTGGTCAATACTAATGGAAGGG + Intronic
1085980512 11:81718512-81718534 CTTGGTTACCACTGCTGAAAAGG - Intergenic
1091400084 12:176155-176177 CTTGGGCACCCCTGCTGGAAGGG - Exonic
1093093340 12:14945174-14945196 CTTGGTCAGCAGTATTGGAGAGG - Intronic
1101061568 12:100977970-100977992 CTTGGTGAACAATAAAGGAAAGG - Intronic
1107784560 13:43941999-43942021 CTTGGTCCTCACTGATGGAAAGG - Intergenic
1109182577 13:59231561-59231583 CTTGGTCAACACAACATGAAAGG - Intergenic
1113817042 13:113179579-113179601 CTTGGTCAGCACTAAGGGAGGGG + Intronic
1115632427 14:35258559-35258581 CTTGGCCCAGACTTCTGGAATGG - Intronic
1120609237 14:86620178-86620200 CTTGTTAAACAATAATGGAAAGG - Intergenic
1125336534 15:38631961-38631983 CTTGGTTCTCACAACTGGAAAGG + Intergenic
1132900330 16:2250656-2250678 CTTGGTAAAACCCACTGGAAAGG - Intronic
1133505249 16:6405560-6405582 CTTGGTCAGAACTAGTGAAATGG + Intronic
1133847493 16:9468999-9469021 CTCTGTCCACATTACTGGAATGG + Intergenic
1140825767 16:78704630-78704652 CTTGGTCTAAACTGCAGGAAGGG + Intronic
1142421625 16:89974077-89974099 CTTGGTGAACACGACAGGCAAGG + Intergenic
1143857772 17:9865022-9865044 CATGGTCAGCTCTACTGAAATGG + Intronic
1144114657 17:12075776-12075798 ATTGGTTATCACTACTGGAATGG - Intronic
1144841979 17:18192321-18192343 CTTGGTTGACACTCCTGGAAAGG - Intronic
1151051293 17:70981955-70981977 CTTTGTAAACAGTACTGGAATGG + Intergenic
1151942736 17:77302821-77302843 CCTGGTCTCCACTACTGGAAAGG + Intronic
1163382574 19:16978586-16978608 TTTGGTCATCACTGCTGGAGGGG + Intronic
1164426737 19:28148310-28148332 CTTGGACAACCCTACAGGATAGG + Intergenic
1166210901 19:41306013-41306035 TTTGGTCAACACTTCTGCACTGG + Intronic
931298878 2:60957462-60957484 CTGGGTTAACACCACTGGGATGG + Intronic
931433051 2:62224821-62224843 ATAGTTCAACACTACTGTAATGG - Intergenic
934864150 2:97791031-97791053 CTTGGTAAACCATTCTGGAAGGG + Intronic
935083020 2:99817148-99817170 CTCGGTCAAGACCACAGGAAAGG + Intronic
939401436 2:141699746-141699768 CTTGTACAATACTACTGGAAAGG - Intronic
941152369 2:161930832-161930854 CTTTGTCAACTTTGCTGGAAGGG - Intronic
943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG + Intergenic
945926879 2:215814877-215814899 ATTGGCCAAAACTACTAGAAAGG - Intergenic
946957376 2:224945835-224945857 CTTGGTCATCACAACTGGGGAGG + Intronic
1169769604 20:9186674-9186696 CCTGGACCACACCACTGGAAAGG - Intronic
1172347162 20:34210570-34210592 CTTGGTCCACACTACTGGCCTGG - Intronic
1173189107 20:40862766-40862788 TTTGGTCAACATTCCGGGAATGG - Intergenic
949502025 3:4689274-4689296 CTTTGTAAACAATACTGCAAAGG + Intronic
952226915 3:31386916-31386938 GTTGGTCAGCAATCCTGGAAGGG - Intergenic
953356673 3:42262192-42262214 CTTAGCAAACACTGCTGGAAGGG - Intronic
954551316 3:51484024-51484046 CTTGTTCATCACTACTGAATGGG - Intronic
954923695 3:54213968-54213990 CTGGGTCAACCCTACTGTAGTGG + Intronic
963239199 3:142986074-142986096 TTTTGTAAACACTACTGCAATGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978871836 4:113587997-113588019 TTGGGTCAACATTTCTGGAAAGG + Intronic
982431612 4:155328382-155328404 CTTGATAAACAACACTGGAAAGG + Intergenic
982511941 4:156293541-156293563 CTTGGTCAACAAAAATGGCAAGG - Intergenic
982593426 4:157347035-157347057 CTGGGTTAACAATACAGGAAGGG + Intronic
991538423 5:67699397-67699419 CTTGGTGAAGTCTACTGGAAGGG - Intergenic
992124995 5:73630849-73630871 CTTGGTCAACACTACTGGAAAGG + Intronic
992918487 5:81485535-81485557 ATTAGTCAACACTACTGAAGAGG + Intronic
994080972 5:95708806-95708828 ATTCGTCAACACTACTTGGAGGG - Intergenic
996397785 5:123031137-123031159 TTTTGCCAACTCTACTGGAAAGG + Intronic
998460773 5:142308488-142308510 CTTGGTCCACACTGCAGGAATGG + Intergenic
1000441709 5:161271575-161271597 CTTAGTCAACAGTACTTGAGGGG - Intergenic
1003041593 6:2693026-2693048 TTTGGTCATCACAACTGGGAGGG - Intronic
1003903088 6:10673323-10673345 TTTGATCAACATCACTGGAAGGG - Intronic
1004290148 6:14359311-14359333 CTTGGTCAACACTTATATAATGG + Intergenic
1004703764 6:18103816-18103838 CTTCTTCAACCATACTGGAAAGG - Intergenic
1009438059 6:63640915-63640937 TTTGGCCATCACAACTGGAAAGG - Intronic
1011028063 6:82891243-82891265 TTTGGTCAACACAACTGGAGTGG + Intergenic
1024820651 7:53325737-53325759 CTTGGTAAACACTTCTTGAGTGG + Intergenic
1028364966 7:90018149-90018171 CTTGGTCTACACTAATTCAATGG - Intergenic
1030432267 7:109465380-109465402 CTTGGTGAAAACTAGTGAAAAGG + Intergenic
1031332574 7:120484222-120484244 GTTGATCATAACTACTGGAAAGG - Intronic
1032345289 7:131110577-131110599 CTTGTTCAAAACTAGTGAAAGGG + Intronic
1032675212 7:134123925-134123947 CAAGGTCCACACTCCTGGAAAGG + Intergenic
1033358497 7:140620779-140620801 CTTGGTCATCTCTAAGGGAAAGG - Intronic
1035090631 7:156307361-156307383 GGTGGTCAACGCTACTGGACGGG - Intergenic
1047187712 8:122649304-122649326 CTTGGTTATCACAACTGGAGCGG - Intergenic
1051441139 9:17084491-17084513 CTTGGTCAAGAATACTAGATTGG - Intergenic
1051486874 9:17618178-17618200 TTTGGTTACCACGACTGGAAAGG + Intronic
1057094537 9:92293930-92293952 CTCGGTCTACACTACTGCAACGG - Intergenic
1057736072 9:97662188-97662210 CTTGGTGAACACCAGTGGTATGG + Intronic
1190775226 X:53547311-53547333 CTCCCTCAACACAACTGGAAAGG + Intronic
1195410218 X:104562097-104562119 TTTGGTCAACTCTAGTGGAGTGG + Intergenic
1195951939 X:110284349-110284371 TTTAGTCACCACAACTGGAAGGG + Intronic
1197007117 X:121514931-121514953 CTTGGTGCAGACAACTGGAAGGG + Intergenic
1198560543 X:137845349-137845371 TCTAGGCAACACTACTGGAAAGG - Intergenic
1198956514 X:142137123-142137145 TGTGGCCACCACTACTGGAATGG - Intergenic
1202341895 Y:23878435-23878457 CTTTGTCACCCATACTGGAAGGG + Intergenic
1202528872 Y:25791651-25791673 CTTTGTCACCCATACTGGAAGGG - Intergenic