ID: 992133615

View in Genome Browser
Species Human (GRCh38)
Location 5:73720344-73720366
Sequence TTGAAAAAGAAGAAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992133613_992133615 -2 Left 992133613 5:73720323-73720345 CCTTGGAAAACTAAGGGACAGTT 0: 1
1: 0
2: 1
3: 9
4: 196
Right 992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992133615 Original CRISPR TTGAAAAAGAAGAAAAAGGA AGG Intronic
No off target data available for this crispr