ID: 992133703

View in Genome Browser
Species Human (GRCh38)
Location 5:73721173-73721195
Sequence GCTGCTCTCCACCATGTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992133698_992133703 11 Left 992133698 5:73721139-73721161 CCTTTGGCCTGGAAGAGCAGGGG 0: 1
1: 0
2: 4
3: 27
4: 363
Right 992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG 0: 1
1: 0
2: 3
3: 7
4: 110
992133696_992133703 12 Left 992133696 5:73721138-73721160 CCCTTTGGCCTGGAAGAGCAGGG 0: 1
1: 2
2: 1
3: 29
4: 215
Right 992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG 0: 1
1: 0
2: 3
3: 7
4: 110
992133700_992133703 4 Left 992133700 5:73721146-73721168 CCTGGAAGAGCAGGGGAAGCCAC 0: 1
1: 0
2: 0
3: 44
4: 293
Right 992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG 0: 1
1: 0
2: 3
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992133703 Original CRISPR GCTGCTCTCCACCATGTATG AGG Intronic
903021718 1:20399768-20399790 CCTGCTCTGCACAATGTATGAGG + Intergenic
905289676 1:36912646-36912668 GCAGCCCCCCACCATGTGTGAGG - Intronic
905302705 1:36996687-36996709 GCTGTTCCCCACCAGGAATGAGG - Intronic
905887167 1:41497515-41497537 GCTGCCCCCCACCAGGGATGGGG - Intergenic
907499893 1:54871397-54871419 GCTGCTCTACTCCCTGGATGAGG - Exonic
908458380 1:64326212-64326234 GCTGCTCCACACCAGGAATGTGG + Intergenic
911733561 1:101313630-101313652 GCTGCTGTCCACCATACAGGCGG - Intergenic
913371900 1:118108631-118108653 GCCTCTCTCCACGATGTTTGAGG + Intronic
915870702 1:159556926-159556948 GCTACTCTCCACTCTGTCTGAGG - Intergenic
921670780 1:217921602-217921624 TCTGCTCTCCACCGTGCATTGGG - Intergenic
1068858447 10:61821818-61821840 GCTACTTTCCACCATATATTTGG + Intergenic
1069919136 10:71805814-71805836 GCTGCGCTCCAACGTGTACGAGG + Exonic
1070662618 10:78318368-78318390 GCTGCTCTACAGCATGATTGGGG - Intergenic
1077058629 11:608095-608117 GATGCTCTCCACCGTGTAGGAGG - Exonic
1077455411 11:2675601-2675623 GGTGCTCTCCACCCTATCTGAGG - Intronic
1082934226 11:58639762-58639784 TTTTCTCTCCACCCTGTATGGGG + Intergenic
1084687560 11:70705774-70705796 ACTGCTAGCCTCCATGTATGTGG - Intronic
1085463052 11:76706790-76706812 GCAACTCTCCACCATGGCTGGGG + Intergenic
1089307571 11:117536258-117536280 TCCGCTCTCCACACTGTATGAGG - Intronic
1089678428 11:120105982-120106004 CCTGCTCTCCACCATGCATCAGG + Intergenic
1100588378 12:96000246-96000268 TCTGCTGTCCACCAGGTAGGTGG + Intergenic
1101328258 12:103735809-103735831 GCTGCTCTCCACAGTGTAAGAGG - Intronic
1103045983 12:117734955-117734977 GCTGCTCAACACCAAGTGTGTGG - Intronic
1103068752 12:117922740-117922762 GCTGTTGTGCACCTTGTATGTGG - Intronic
1103393871 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG + Intergenic
1106306550 13:28516231-28516253 ACTGCACTCCAGCATGGATGTGG + Intergenic
1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG + Intergenic
1116798088 14:49413205-49413227 GCTGCTCCCCACCCTGAGTGAGG - Intergenic
1117437683 14:55732529-55732551 GCTTCTCTCCCCAATATATGAGG - Intergenic
1119847227 14:77839554-77839576 ACTGCTCTCCACCCTGCAGGTGG - Intronic
1120357427 14:83452526-83452548 ACTGATCTCCTCCATGTTTGGGG - Intergenic
1126462341 15:48927312-48927334 CCTGCTCTCCAGCCTGTGTGGGG - Intronic
1127825345 15:62697914-62697936 GCTGGTGTCCACCCTGCATGCGG - Intronic
1130881736 15:88061418-88061440 GCTGCCCTCCACAAGGTGTGGGG + Intronic
1131370469 15:91876811-91876833 TCTGCTGTCCAGCATGGATGTGG + Intronic
1137262043 16:46839112-46839134 GCTGCCTTCCTCCATGCATGCGG - Intergenic
1137637668 16:50001214-50001236 ACTGCCCTCCACCATGTGGGTGG + Intergenic
1138836956 16:60448990-60449012 CCTGCCCTCCAGCATGAATGTGG - Intergenic
1138925213 16:61581859-61581881 GCTGCCCTCCACCAAGTTGGAGG - Intergenic
1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG + Exonic
1139727839 16:68916237-68916259 GCTGCTCACCTCCAGTTATGCGG - Intronic
1141919636 16:87127339-87127361 GCCGCAGTCCACCATGTCTGAGG - Intronic
1143432524 17:6897684-6897706 GCTGCTCACCCCCATGAATCAGG - Intronic
1143439695 17:6959974-6959996 GCCCCACCCCACCATGTATGGGG + Intronic
1144541828 17:16150639-16150661 GCTGCTCTCCAGACTGTATCAGG + Intronic
1146884554 17:36462424-36462446 GCTGCTCTGCCCCATGGTTGAGG - Intergenic
1150076664 17:62198067-62198089 GCTGCTCACCACCACACATGAGG - Intergenic
1151767624 17:76140381-76140403 CCAGCTCTCCGCCATGTCTGCGG + Exonic
1155103600 18:22638959-22638981 TCTGCTTTTCAACATGTATGTGG + Intergenic
1155479313 18:26268280-26268302 GCTGATCTCCAACATGTATGAGG - Intronic
1160336727 18:78048358-78048380 ACCCCTCTCCACCATGAATGTGG + Intergenic
1165059230 19:33196675-33196697 GCTGGTCCCCAGCAGGTATGTGG + Intronic
1168171422 19:54592440-54592462 GCTCCACTGCACCATGTATAGGG - Intronic
925437913 2:3857182-3857204 GCTGCTCACCAAGATGTCTGGGG + Intergenic
926301268 2:11604837-11604859 GCTTCTTGCCACCATGTGTGTGG + Intronic
927166239 2:20325306-20325328 GCTGCTATCCACCAGGTAGCAGG + Intronic
930225398 2:48787136-48787158 GCTTCTTTCCTCCATGTATAGGG - Intergenic
935652759 2:105396434-105396456 GCTGCTCTCCATAATGTGAGTGG - Intronic
937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG + Exonic
939078914 2:137636817-137636839 GCCTCTCTCCACCATATATCAGG + Intronic
940850352 2:158682441-158682463 GCTGAGCTCCGCCAGGTATGAGG - Intronic
944121565 2:196246165-196246187 GCTGCTCTCCTAGATGAATGAGG + Intronic
948124379 2:235554272-235554294 GCTGCTCCGCACCATTTATTTGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1169204068 20:3730369-3730391 GCTCCTCTCCAGCATGGTTGTGG - Intergenic
1174871355 20:54185849-54185871 GCTGCTCGCCACCCTTTAAGAGG + Intergenic
1175633624 20:60562109-60562131 CCTGCTCTCCACCGAGTATTTGG - Intergenic
1178363680 21:31970541-31970563 GCTGCTCTCCATCATGAGTATGG - Intronic
1181394218 22:22607477-22607499 ACTGCTCTCCACAATGCATGTGG - Intergenic
952014107 3:28936683-28936705 GATGCTTTGCACCATGTGTGTGG + Intergenic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
954679157 3:52332272-52332294 GCTGCTCTACAACTTGTATGTGG + Exonic
958267454 3:91455991-91456013 ACTGCTCTCCCCAATGTAGGAGG + Intergenic
959277211 3:104291606-104291628 GCTATTCACCACCATGTAGGAGG - Intergenic
960962591 3:123082806-123082828 TCTCCTCTCCACCTTGTAGGTGG + Intronic
961032484 3:123618601-123618623 GCTTCTCTTCACCATGAATAGGG - Intronic
961646947 3:128397785-128397807 GCTGCTCTGGCCCATGGATGGGG + Intronic
968880728 4:3297787-3297809 GCTGCTGTCCTCCATCTGTGGGG + Intronic
969160344 4:5252261-5252283 GTGGCTCTCCACCATGTTTTAGG + Intronic
969306799 4:6330474-6330496 GCTGCCCTCCATCATGTGGGGGG + Intronic
969589950 4:8116091-8116113 TCTCCTCTCCACAATGTCTGTGG - Intronic
973893923 4:55394038-55394060 GCTACAGTTCACCATGTATGGGG - Intergenic
976482429 4:85560324-85560346 GATTCTCTCTACAATGTATGAGG + Intronic
977846515 4:101773634-101773656 GCTGCTCAGCACCATGGATATGG + Intronic
977890211 4:102301230-102301252 ACTGCTCTCCAGCATTGATGTGG + Intronic
981844869 4:149155711-149155733 GCTACTCTGCACCAAGTAAGTGG + Intergenic
986745186 5:10737444-10737466 CCTGTTCTCTACCATGTGTGTGG - Intronic
987179649 5:15354195-15354217 GCTGCTTTCCATAATGTATGCGG - Intergenic
990305288 5:54488696-54488718 GCTGCACTCCAGCCTGTGTGAGG - Intergenic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
995486179 5:112642199-112642221 TCTTCTCTTCACCATGTAGGAGG - Intergenic
999945537 5:156591461-156591483 ACTGCTTTCCTCCATGTAGGTGG - Intronic
1002320780 5:178374410-178374432 GCTGCTGTCCACGGTGTCTGTGG - Intronic
1004368839 6:15034878-15034900 GCTGCTCTTCTCCTTGTAGGGGG + Intergenic
1008134084 6:47752929-47752951 GGGGCTCTCCACCATTGATGTGG - Intergenic
1008987762 6:57565613-57565635 ACTGCTCTCCCCAATGTAGGAGG - Intronic
1009176365 6:60464213-60464235 ACTGCTCTCCCCAATGTAGGAGG - Intergenic
1010947796 6:81998540-81998562 GTTGCTCTCCCTCATGTATTGGG - Intergenic
1011855390 6:91683399-91683421 TCTGCTCCACAGCATGTATGTGG - Intergenic
1013635488 6:112025482-112025504 ACAGCTCTGCACCATGCATGGGG + Intergenic
1014781457 6:125569774-125569796 ACAGCTCTCCACAATGTAGGTGG + Intergenic
1014962480 6:127704249-127704271 ACTGCTCTGAATCATGTATGAGG + Intergenic
1016582808 6:145648251-145648273 GCTGGTCTCTACCTTTTATGTGG - Intronic
1023939804 7:44762124-44762146 CCTGCTCTCCACCCTGCAAGGGG - Intronic
1025029406 7:55544700-55544722 TCTGCTCTCCACCAACTCTGCGG - Intronic
1026045054 7:66901429-66901451 GCTGCTCACCACCAGCTCTGTGG - Intergenic
1033783785 7:144705013-144705035 GCTGCTCTTCAACATGTGAGAGG + Intronic
1037813176 8:22098493-22098515 GCTGCTCTGTACCAGGTAGGTGG - Exonic
1037936710 8:22919865-22919887 GCTGGTCTCCACCAGGCTTGGGG + Intronic
1044919630 8:97155351-97155373 TCTGGGCTCCACCATCTATGGGG - Intergenic
1046795340 8:118365389-118365411 GCTGCCCTCACCCATGTAGGTGG + Intronic
1053392074 9:37742966-37742988 GCTGCTCCCCACAATCTCTGAGG - Intronic
1056328959 9:85505851-85505873 GCTCCTCTCCATCATGGCTGAGG + Intergenic
1057028460 9:91755366-91755388 ACTGCTCTCCAATATGTCTGAGG + Intronic
1186356595 X:8798717-8798739 GCAGCTCTTCTCCATGGATGCGG - Intronic
1186795411 X:13043485-13043507 GCAGCTCTTCTCCATGGATGCGG - Intronic
1189588370 X:42485182-42485204 GCTGCTCTCTACCATGAACTGGG - Intergenic
1191913241 X:66173871-66173893 GCTGCTGTCCAATATGTAGGTGG - Intronic
1196840873 X:119857976-119857998 GCTCCTTTCCACCAAGTAAGGGG + Intergenic
1201099262 Y:10659018-10659040 GCTGCACTCCAGCATGGGTGAGG - Intergenic
1201534432 Y:15030558-15030580 GCTGCTCTCCTCCTGCTATGTGG + Intergenic