ID: 992136636

View in Genome Browser
Species Human (GRCh38)
Location 5:73752702-73752724
Sequence CAGGAGTAACTGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992136636 Original CRISPR CAGGAGTAACTGAAAGAAGA TGG Intronic
901013428 1:6213671-6213693 CAGGAGTAGGTCAAAGCAGAAGG + Intronic
901257116 1:7839236-7839258 CTTCAGTAACTGAAAGAAGATGG - Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
902939688 1:19791760-19791782 CAGGAGTCACTGACGGAAGGAGG + Intronic
902996037 1:20225897-20225919 CAGGAGGAAGAGAAAGAAGGGGG + Intergenic
903221836 1:21873632-21873654 CAGGAGTTTCAGAAAGAAGCAGG + Intronic
903502195 1:23806971-23806993 CCGAAGTAACTGATGGAAGAGGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
905493824 1:38368137-38368159 CAGAAATAAATGAAAGAAAAAGG - Intergenic
905624517 1:39479132-39479154 AAGGAGTAACTGCAAGTAGGAGG - Intronic
906127400 1:43435657-43435679 CGGCAGTAACTAAAGGAAGATGG + Intronic
906189439 1:43886614-43886636 CATGTGTAAATGCAAGAAGACGG + Intronic
906225747 1:44119719-44119741 TAGGAGGAACTGAAAGACCAGGG + Intronic
908515665 1:64890322-64890344 CAGCTGTAAATGAAAGATGAAGG + Intronic
909263774 1:73529909-73529931 CAGAAGGAACTGAAAGCACATGG + Intergenic
910977675 1:92924456-92924478 CAAGGGGAACTGAAAAAAGAGGG + Intronic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
912764637 1:112396966-112396988 CAGAAGGAACAGAAAGTAGAAGG - Intronic
914396437 1:147273577-147273599 CAGGAGAAACTGAAAGAATCAGG + Intronic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
915495411 1:156279195-156279217 CAGGGGTTACTGTAACAAGATGG - Intronic
916155823 1:161846089-161846111 CAATAATAACTGAAATAAGAAGG - Intronic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
920408855 1:205742004-205742026 CAGTAGTCACTCAAGGAAGAGGG + Intronic
921116889 1:212100364-212100386 TAGGAGTATTTGAAGGAAGAGGG - Exonic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921618143 1:217296249-217296271 CATGTGTAACTTAAAGAAAAAGG - Intergenic
921954727 1:220970318-220970340 CAGAAGAGACTGAAAGAAAAAGG + Intergenic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
923247574 1:232147458-232147480 AAGGAGGAAGTGAAGGAAGAAGG + Intergenic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
923795520 1:237151014-237151036 CAGGAGTCACTGGAAAAAGTAGG + Intronic
924313975 1:242776576-242776598 CAGGAGCAAGAGAAAGGAGAGGG + Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
1063297177 10:4818178-4818200 CAGGAGGAAATAAAGGAAGAGGG + Intronic
1063720341 10:8574214-8574236 CAAGAGTAACTGAGATAAGTTGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1064807103 10:19147829-19147851 AAGGAATTACTGAGAGAAGACGG + Intronic
1066167706 10:32805974-32805996 CAGGAGCAAGAGAAAGAAGGGGG + Intronic
1067910410 10:50340871-50340893 TAGAAGAAACTGAAATAAGAAGG + Intronic
1068330007 10:55551308-55551330 CAACAGTAACTGAAAGAATAAGG - Intronic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1071119588 10:82261967-82261989 CAGGAGTAAGAGAAAGAAGGGGG - Intronic
1072752245 10:97989969-97989991 GAAGGGTCACTGAAAGAAGAGGG - Intronic
1073094685 10:100972432-100972454 CAGGGGGCACTGAAAGAAGGAGG - Intronic
1073369837 10:102977879-102977901 CAGGAGGAACTCAAAGACCAAGG - Intronic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073668428 10:105560076-105560098 AAGAAATAAATGAAAGAAGAAGG - Intergenic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1077944775 11:6884273-6884295 TAGCAGTCACTGAAATAAGAGGG + Intergenic
1079980974 11:27151159-27151181 CAGGAGGAAGAGAAAGAAAAAGG + Intergenic
1080872772 11:36251631-36251653 CACCAGTAACAGCAAGAAGATGG + Intergenic
1081659369 11:44878447-44878469 CAGGAGGAAAGGAAAGAATAAGG + Intronic
1081702384 11:45159913-45159935 CAGGAGTCACTGGGGGAAGATGG + Intronic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1085074609 11:73579513-73579535 GAGGAATAACTGGAAGAAGGAGG + Intronic
1086260434 11:84933247-84933269 CTACAGTAACTGAAAGAGGATGG - Intronic
1086871196 11:92038956-92038978 CAGGAAGAACTGAAAGGAAAAGG + Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087552764 11:99672855-99672877 CAGGTGGAAAGGAAAGAAGATGG + Intronic
1087759143 11:102087128-102087150 CAAAAGTAACTTAAAGAAGAGGG + Intergenic
1087860347 11:103145442-103145464 CAGCATTAAGTCAAAGAAGATGG - Intronic
1088323546 11:108578413-108578435 CAGCAGTAACTAAAATAACATGG - Intronic
1088331546 11:108659045-108659067 GAGAAGTAACTGAACCAAGATGG - Intergenic
1088729069 11:112664767-112664789 CAAGAGAAACTGAAAAAAAAAGG + Intergenic
1089508086 11:118978373-118978395 CAGGAGGAAGAGCAAGAAGATGG + Intronic
1091629344 12:2147616-2147638 CAGAACTAACTGGAGGAAGAGGG + Intronic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1093854572 12:24085053-24085075 AAGGACTACCTGAAAAAAGAGGG + Intergenic
1094630829 12:32172162-32172184 GATCAGTTACTGAAAGAAGAGGG + Intronic
1096861005 12:54528110-54528132 GAGAAGAAACTCAAAGAAGATGG - Intronic
1097361736 12:58665924-58665946 CAGAAGCAAGAGAAAGAAGAGGG - Intronic
1098573700 12:72016809-72016831 CTGGAGGAAGTGAAAGAAGTAGG + Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099241447 12:80143757-80143779 CAGGAGTAACTAACAGAACATGG + Intergenic
1099566727 12:84258500-84258522 CAGGAATAATTTAACGAAGAAGG - Intergenic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099612834 12:84896818-84896840 AAAGATTAACTGAAAGAAAAAGG + Intronic
1099765560 12:86978654-86978676 CATGATTAACTGAAGGAAAATGG + Intergenic
1100647608 12:96547774-96547796 GAGGAGGAAACGAAAGAAGAAGG - Intronic
1100910092 12:99350167-99350189 CAGGAGGAAGAGAAAGAAGGGGG - Intronic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101509659 12:105381197-105381219 GAGGAGTAACCGAAATCAGAAGG - Intronic
1101581477 12:106045853-106045875 CAGGAGGGACTGAAAGTTGAAGG - Intergenic
1101972295 12:109323780-109323802 CAGGAGTAACTGAAGCAATAAGG - Intergenic
1102517510 12:113459815-113459837 CAGGAGAAAAGGAAAGAATAAGG - Intergenic
1102562031 12:113769225-113769247 GAGGAGAAAATGAAAGCAGACGG + Intergenic
1102667081 12:114583777-114583799 CAGGAGGAAAAGAAAGAAAAGGG - Intergenic
1102760495 12:115380721-115380743 CAGGAGGAAGTGAAAGAGGGAGG + Intergenic
1102895099 12:116592480-116592502 CAGGATTTGCTGAAATAAGATGG - Intergenic
1105655320 13:22430408-22430430 CAGGAGAATGTGAGAGAAGAGGG + Intergenic
1105680751 13:22724983-22725005 CAGGATTATGTGAAATAAGAGGG - Intergenic
1105971390 13:25432066-25432088 CAGCAGTAAATAAAAGAATAAGG - Intronic
1106238151 13:27883295-27883317 AAAAAGTAACTGATAGAAGAAGG + Intergenic
1106356391 13:28987432-28987454 GAGGAGTAAATGAGAGATGAGGG + Intronic
1107131331 13:36899545-36899567 CAGGAGGAACTAAATGAAGTCGG + Intronic
1107429872 13:40330765-40330787 CAACAGTAACAGAAAGCAGATGG - Intergenic
1107535347 13:41324013-41324035 GAGGAGTAAGTGAAATAGGATGG - Intronic
1108333389 13:49413285-49413307 AAGGAGTAAGTGAAAGAAATGGG + Intronic
1108664542 13:52616851-52616873 CTGGAGTAACTGGAAGAAACAGG - Intergenic
1108902581 13:55430876-55430898 AAGGAGCAAGTGATAGAAGAAGG - Intergenic
1109129068 13:58557641-58557663 GTGGAGTAACAGAAAGAAAATGG - Intergenic
1109818932 13:67625709-67625731 CAGGTATAACTGCAAGGAGAAGG + Intergenic
1111170163 13:84516546-84516568 CAGGAGCAAGTGAAAGAGTATGG - Intergenic
1111887388 13:94039448-94039470 TAGAGGTGACTGAAAGAAGAGGG + Intronic
1112261759 13:97884022-97884044 CAGGAGGAACTGGAAGGAGGTGG + Intergenic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1112765482 13:102737525-102737547 CAGGAGCAAGGGAAAGAGGACGG - Exonic
1113117150 13:106885698-106885720 CAGGAGTGCATGCAAGAAGAGGG - Intergenic
1114708961 14:24757864-24757886 CAAGCATATCTGAAAGAAGAGGG - Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1116932688 14:50705440-50705462 AAGCAGTGACTGAAAGCAGAAGG - Intergenic
1117200541 14:53385462-53385484 CAGCAGTCACTGAAAGGAGCAGG - Intergenic
1118518329 14:66551769-66551791 CAGGAGGAAGAGAAAGAAGGAGG + Intronic
1118664334 14:68050355-68050377 CAGGAGAAAATGAAAGATGATGG - Intronic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1120025386 14:79578135-79578157 CAGGACTAACTGAAAGCTGTTGG + Intronic
1120090790 14:80331227-80331249 AAGGAGTGAATGAAAGAGGAAGG - Intronic
1120441719 14:84549431-84549453 CACCAGAAACTGAAAGAGGAAGG + Intergenic
1121108953 14:91299404-91299426 CAGTAGGAGCTGAAACAAGAAGG + Intronic
1121148583 14:91608122-91608144 CAGGAATAGCTGTAAGAGGAGGG + Intronic
1121307834 14:92917996-92918018 CAGGAGTCACTGGGAGAAGATGG - Intergenic
1121636997 14:95460800-95460822 CAGGAGTAACAGACAGAGGCTGG + Intronic
1121806566 14:96831062-96831084 GAAAAGCAACTGAAAGAAGAAGG - Intronic
1121809690 14:96872808-96872830 TAGTAGTAACTAAAAGAAAAAGG - Intronic
1122340686 14:101026484-101026506 CTTGAGTAACTGAGAAAAGATGG + Intergenic
1124529197 15:30488670-30488692 CAGGAGTAAGGGAAAAAACAAGG - Intergenic
1124769465 15:32519023-32519045 CAGGAGTAAGGGAAAAAACAAGG + Intergenic
1125077588 15:35637510-35637532 CAAGAGAACCTGATAGAAGAAGG - Intergenic
1125897090 15:43311584-43311606 CAGGAATAATTGAGAGAATAGGG + Intergenic
1126345458 15:47689219-47689241 AAGGGGTGACTGAAACAAGAAGG - Intronic
1126873010 15:53009845-53009867 CCGGTTTAACTGAGAGAAGATGG + Intergenic
1127987845 15:64088219-64088241 GAAGAGTCACTGAAAGGAGATGG + Intronic
1129661935 15:77557656-77557678 CAGGAGGTACTCAAGGAAGAGGG - Intergenic
1129706904 15:77799538-77799560 CAGAAGTAACTCAAAGAATGTGG + Intronic
1130682519 15:86009114-86009136 AAGGAGGAAAGGAAAGAAGAAGG + Intergenic
1131797694 15:96036509-96036531 TAGGCGTATCTAAAAGAAGAAGG - Intergenic
1131856768 15:96605629-96605651 CAGGAGGAGCTGGAAGATGACGG + Intergenic
1131871253 15:96767466-96767488 CAAGAGGAACAGAAAAAAGAGGG - Intergenic
1132128926 15:99256051-99256073 TTGGAGTTACTGAAAGATGAGGG + Exonic
1132477302 16:147050-147072 CATGAGAGAGTGAAAGAAGATGG + Intergenic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135734742 16:24921663-24921685 CAGGAGTAACTGTGAGAAAAAGG - Intronic
1135842215 16:25887170-25887192 AAGGAGTAACAGAAAGCTGATGG + Intronic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1137418003 16:48303344-48303366 TAGGAGTGAGTGACAGAAGAAGG + Intronic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1139159812 16:64490954-64490976 GATGAATAACTGGAAGAAGATGG - Intergenic
1139159872 16:64491552-64491574 AATGAATAACTGGAAGAAGACGG - Intergenic
1140339851 16:74146773-74146795 CTGGAGGTACTGAAAGAAGCTGG + Intergenic
1140942443 16:79734599-79734621 AAGGAGTTACTGAAAAAAAATGG - Intergenic
1141598707 16:85112582-85112604 CAGGAGCTGCTGAGAGAAGAGGG + Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1143444807 17:7001396-7001418 CAGGAGGGACTGGAAGAAGGGGG - Intronic
1144767225 17:17739427-17739449 CAGGAGGGAGAGAAAGAAGAGGG + Intronic
1146040022 17:29443323-29443345 CAAGAGCAACAAAAAGAAGATGG - Intronic
1148067311 17:44881525-44881547 CTGGAGTAACTGGGGGAAGAAGG + Intronic
1148318246 17:46723711-46723733 GAGGAGGAACTGAAAGAACTTGG - Intronic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148833681 17:50453559-50453581 TGAGAGTGACTGAAAGAAGATGG + Intronic
1149560657 17:57605757-57605779 CAGAGGCAGCTGAAAGAAGAGGG - Intronic
1150059034 17:62048101-62048123 TAGGTGTAACTGAAAAGAGAAGG + Intronic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151852036 17:76696659-76696681 CAGGAGGAACTATGAGAAGAGGG + Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1154928978 18:20972783-20972805 CAAGAGAGAATGAAAGAAGACGG + Intronic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156582036 18:38388573-38388595 CAGGAAAATCTGAAAGGAGAAGG - Intergenic
1157060600 18:44284053-44284075 CAGGAGAATATTAAAGAAGATGG + Intergenic
1157640616 18:49209707-49209729 CAGGTATAACTGAAAGACAAAGG + Intronic
1158329046 18:56341233-56341255 AAGGTATAATTGAAAGAAGATGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159336212 18:67070743-67070765 CATGAATAAATGAATGAAGAAGG - Intergenic
1160257830 18:77262379-77262401 CAGTAGTAAATCAAAAAAGATGG + Intronic
1161783051 19:6306451-6306473 GAGGAGGAAATGAAAGAGGATGG + Exonic
1162341954 19:10096583-10096605 GAGGAGGAACGGAAGGAAGACGG + Intronic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1164411721 19:28011835-28011857 CACCAGAATCTGAAAGAAGAAGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164731615 19:30509173-30509195 CAAAAGTAACTGAACCAAGAAGG + Intronic
1164957809 19:32402187-32402209 CAGGAGGAAGAGGAAGAAGAAGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165281823 19:34804260-34804282 TAGGAGTAATTGAAGAAAGATGG - Intergenic
1168173502 19:54606901-54606923 CAGGAGTGTTTGAAAGAAGACGG + Intronic
1168431747 19:56287102-56287124 CAGGAGTAACAGAAACCACAAGG - Intronic
925168631 2:1736730-1736752 CAGGAGTAGCTAAAAGTAGGAGG + Intronic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
926186505 2:10695038-10695060 CAGGAGCAAAGGCAAGAAGAGGG - Intergenic
926259597 2:11246321-11246343 CAAAAGTAAATGAAAGAAGAGGG + Intronic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927033738 2:19150531-19150553 CAAGAGGAACTGTAAGAAGAGGG - Intergenic
927275846 2:21261745-21261767 CAGGAGCCACTGAAATGAGAGGG + Intergenic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928316316 2:30249491-30249513 CTGGAGTAAGTGAAAGGAGGAGG + Intronic
928884274 2:36130385-36130407 CACAACTAACTGAAAGGAGAAGG + Intergenic
928978159 2:37110503-37110525 CAGGAGATACTGAAAGCAGCAGG + Intronic
929755158 2:44758120-44758142 CAGAAGTAACTGCAAAATGAAGG + Intronic
930284511 2:49411121-49411143 CAGGAGCAACTTAAAGATCATGG - Intergenic
930568592 2:53055488-53055510 CAGGAGGAAGAGCAAGAAGAGGG - Intergenic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
931669775 2:64636633-64636655 CAGGAGGAACTCAAACAGGAAGG - Exonic
932037963 2:68267443-68267465 CAAGAGTAACCGAAACAGGATGG + Intergenic
932452356 2:71820413-71820435 AAAGAGTAAATGAAAGAAAATGG + Intergenic
932747265 2:74344302-74344324 CAGAAGAGACTGGAAGAAGAGGG - Intronic
933099674 2:78237254-78237276 CATGAGTAACTGATAAAAGGAGG + Intergenic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
935807539 2:106763686-106763708 CAGGAGATGCTGATAGAAGATGG - Intergenic
936830411 2:116638328-116638350 CTGTAGTAACTAAAAGAACATGG + Intergenic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
938794090 2:134704144-134704166 CTGGAGCACCTGAAAGAAGCAGG - Intronic
939460097 2:142488183-142488205 CAGAAGTGTCTGAAAGTAGAGGG + Intergenic
939658236 2:144854029-144854051 CAGGAGTAAAAAAAAGAAGCAGG - Intergenic
941001639 2:160208667-160208689 AATGAGTAAATGAAAAAAGAAGG - Intronic
941149348 2:161894427-161894449 AAGGAGTAAGGGAAAGAAAAAGG - Intronic
943243300 2:185414685-185414707 CCTGAGTAACTGAAACAACAGGG + Intergenic
943789880 2:191920338-191920360 CAGGACTAAAAGAACGAAGATGG + Intergenic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
944646628 2:201786795-201786817 CAGCAGTAACTGAAACAAGTGGG + Intergenic
945689195 2:213011259-213011281 CAGGTGTACCTGGAAGGAGATGG + Intronic
946446532 2:219744823-219744845 CTGATGTAACTGAAAAAAGAGGG - Intergenic
947265882 2:228280456-228280478 CAGCAGTAACTGAAAGGGAATGG + Intergenic
948173018 2:235921008-235921030 GACCAGTAACTAAAAGAAGATGG - Intronic
948277965 2:236724649-236724671 GAGGAATATCTGAAGGAAGATGG - Intergenic
948536471 2:238650975-238650997 CAGGAGTGAGTGATAGAAGGAGG - Intergenic
948774912 2:240280217-240280239 CAGGAAGAAAGGAAAGAAGAAGG + Intergenic
1169276778 20:4238498-4238520 GAGGAGTAACTGAAAGAGTAAGG + Intronic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169503258 20:6181961-6181983 CACGACTAACTCAAAGGAGACGG - Intergenic
1170083211 20:12499738-12499760 CTGTTGTAACTGAAAGAACATGG - Intergenic
1170696121 20:18660545-18660567 AAGCAGAAACTGAAAGAAAAAGG + Intronic
1172494167 20:35366791-35366813 CAGGAGTAAAAGAAAAAAAAAGG + Intronic
1174716404 20:52763434-52763456 CAGGACTCACTTAAACAAGATGG + Intergenic
1174959779 20:55142613-55142635 CAATAGAAACTGGAAGAAGAAGG + Intergenic
1176357865 21:5967307-5967329 CAGGAGTGAGTCAAAGCAGAGGG + Intergenic
1176359960 21:5986886-5986908 CACGAAGATCTGAAAGAAGAGGG + Intergenic
1178102384 21:29283683-29283705 CAGGAGGAAGGGAAAGAAGGGGG + Intronic
1179157118 21:38860212-38860234 CAGGAGTCAAGGAAAGATGAAGG + Intergenic
1179291219 21:40019933-40019955 CAGGAGGAAGGGAAAGAAGGAGG - Intronic
1179763558 21:43551664-43551686 CACGAAGATCTGAAAGAAGAGGG - Intronic
1179765653 21:43571244-43571266 CAGGAGTGAGTCAAAGCAGAGGG - Intronic
1181161540 22:20962855-20962877 CAGGAGAACCTGACAGTAGAGGG + Intergenic
1182487535 22:30648297-30648319 CACGGGGAACTGAAAGAAGTCGG - Intronic
1183767927 22:39896541-39896563 TAGAGATAACTGAAAGAAGAGGG + Intergenic
1183789662 22:40056019-40056041 TAGGAGTAAATGAAGGAAAATGG - Intronic
1183847660 22:40555436-40555458 CAGGAGCAAGAGAAAGAAGGGGG - Intronic
1184449807 22:44576137-44576159 GAGGAGTAAGAGAAAGAAGGAGG + Intergenic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
951392284 3:22121175-22121197 TAGAAGTAAGTGAAAGAGGAAGG - Intronic
951421466 3:22490892-22490914 CAGTAGGAATTGAAAGATGAAGG - Intergenic
951632429 3:24736468-24736490 CAGTAGTAGTTGGAAGAAGAGGG + Intergenic
952878744 3:37969812-37969834 CATGGGTGACTGAAAGAAGGAGG - Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953722394 3:45367967-45367989 CAGGATTAGCTGAAACAAGAAGG + Intergenic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
955569370 3:60287833-60287855 CAGTAGTAAATGAAAGAGGCTGG - Intronic
956979941 3:74624481-74624503 GAGGAATGACTGAAAGAAAAAGG + Intergenic
957017811 3:75090343-75090365 GAGAAGCAACTGAAACAAGATGG - Intergenic
957070636 3:75565135-75565157 CAGGTATAACTAAAAGAAGATGG + Intergenic
957508850 3:81160907-81160929 GAGGAGTAAAGGAAGGAAGATGG + Intergenic
957847421 3:85755684-85755706 CAGGAGGAAGTGAGAGAAGGGGG + Intronic
958686974 3:97411127-97411149 CAGCATTACCTGAAAGAAAATGG + Intronic
959192080 3:103126771-103126793 AAGGAGCAAGTGAAAGAAAAAGG + Intergenic
959293031 3:104498962-104498984 CATGAGTCACTGGAAGAAGGGGG + Intergenic
959367204 3:105476471-105476493 CAGAAGTCTGTGAAAGAAGATGG - Intronic
960391805 3:117085996-117086018 CAGGTGGAAGTGAAAGAAAAAGG - Intronic
960588544 3:119343884-119343906 GAGGAGGAACTGAGAAAAGATGG - Intronic
961429479 3:126871231-126871253 TAGGAGTGACAGAAACAAGAAGG - Intronic
961976543 3:131030913-131030935 CAGGAGGAACAGAAAGCAGAAGG + Intronic
961997259 3:131259209-131259231 CAGGAGGAAAAGGAAGAAGATGG - Intronic
962150027 3:132882794-132882816 CAGGAGAAACTTGAAGGAGAGGG + Intergenic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962602987 3:137009370-137009392 CTGGGGCCACTGAAAGAAGATGG + Intronic
963885626 3:150579212-150579234 GAAGAGTAAATAAAAGAAGAGGG - Intronic
968354722 3:198096349-198096371 CAGAAATAAATGAAACAAGATGG + Intergenic
970148533 4:13065003-13065025 CAGGAGTACCTGAAAGAGAAGGG - Intergenic
971257651 4:25029694-25029716 CAGGAGGAACTGACAGGAAAGGG - Intronic
971283278 4:25260767-25260789 AAGGATTAAGTGAAAGAAGGAGG - Intronic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
973535766 4:51880505-51880527 CAGGAGCCACGGAAAGCAGAGGG - Intronic
973963921 4:56141032-56141054 TAGGAGTCAGTGAAAGAGGAGGG + Intergenic
975252299 4:72194201-72194223 CAGGAGCAACAGAGAGAAGGAGG - Intergenic
975358891 4:73442716-73442738 AAGGAGTAAGTGAAAGAAAACGG + Intronic
976041620 4:80892118-80892140 CTGTAATAACTGAAAGAACATGG + Intronic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976914028 4:90347717-90347739 GCAGAGTAACTGATAGAAGAGGG + Intronic
977109388 4:92933896-92933918 GAGGAATATCTGAAAGTAGAAGG + Intronic
977162832 4:93657661-93657683 CAGAAGTGACTGGAAGTAGAGGG - Intronic
978577575 4:110201782-110201804 AAGGAGTAATTGAAAGAAACAGG + Intergenic
978979708 4:114928492-114928514 TTGGAGTAAGTGAAAGAAAATGG - Intronic
979130713 4:117041214-117041236 AAGGAGGAAATGAAAGAAAAAGG - Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980085922 4:128389925-128389947 AAGGAGTAATTGAAAGAAATAGG - Intergenic
981618940 4:146671975-146671997 CACAAGGAACTGAAAGAATATGG - Intergenic
982400868 4:154966425-154966447 CAGGAGCAAGAGAAAGAAGAAGG - Intergenic
983402491 4:167282554-167282576 AAGGAAAAACTGAAAGAAGGAGG + Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
986301568 5:6482061-6482083 CTGGTGTCACTGTAAGAAGAGGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
988250860 5:28756254-28756276 CATGAATAAGTGAGAGAAGATGG + Intergenic
988271563 5:29023849-29023871 CAGGAGTTACAGAAAAAAAATGG - Intergenic
988323175 5:29727088-29727110 CAGTAATAACTCAAAGAAAAGGG - Intergenic
988413776 5:30919717-30919739 CAGGAGTTACTAAAAGAAAGAGG + Intergenic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
992059595 5:73029219-73029241 CATGAGTAACTGAAAGGATATGG + Intronic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
992642878 5:78784071-78784093 GAGGAGTAAATGAAAGGACAGGG - Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993525633 5:88962144-88962166 AATGAGTAACAGAAAGAAAAGGG - Intergenic
993715059 5:91268322-91268344 CAGGAGAAGATGAAAGAAAAAGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994051798 5:95370222-95370244 CAGGAGTTACTGTAAGAAGATGG - Intergenic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
995123917 5:108561432-108561454 CAGGAGAAAGTGATAGGAGAGGG - Intergenic
995636093 5:114192614-114192636 CGGGAGTCCCTGAAAGGAGAAGG + Intergenic
996284466 5:121771924-121771946 CACCAGAAACTGAAGGAAGAGGG - Intergenic
996443939 5:123522593-123522615 CAGGAATAACCTAAAGAATAGGG - Intronic
998659445 5:144219867-144219889 CAGGAGAAACTGAGAGCAGATGG + Intronic
999768669 5:154757964-154757986 TAGGAGGGACTGAAAGAAAACGG - Intronic
1001085624 5:168698359-168698381 CAGGTGTCTCTAAAAGAAGATGG + Intronic
1001775994 5:174329380-174329402 CAGGAGTAAATGCAGAAAGAGGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002687292 5:181023851-181023873 CAGGATTAACTCAAAAAAAAAGG + Intergenic
1003490121 6:6613838-6613860 GAGGAGTGACTGAAGGAAGGCGG - Intronic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004529094 6:16437004-16437026 CCTGAGTAACTGGAAGGAGATGG + Intronic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1005322315 6:24667178-24667200 CAGAAGTTAGTGAAAGAAGGAGG - Exonic
1005926783 6:30451506-30451528 CAGGAGGCTCTGAAGGAAGAGGG + Intergenic
1006594221 6:35181279-35181301 CGGGAGTAATGGAAAGAATAAGG - Intergenic
1007323927 6:41046080-41046102 CTGGAACAACTGAAAAAAGAAGG + Intronic
1007591000 6:43020965-43020987 CAGGAGCAGCTGAAAGGAGGTGG - Exonic
1007596313 6:43053355-43053377 CTGGAGCAACTGGAACAAGAGGG + Intronic
1008706784 6:54171010-54171032 CAAGAGTAGATAAAAGAAGAAGG - Intronic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1009560188 6:65230665-65230687 CAGGAGTATGTGAAAAATGAGGG - Intronic
1010174855 6:73016472-73016494 CATCAGTAAATGAAAGGAGATGG + Intronic
1010288388 6:74106869-74106891 CAGGCTTTACTGAAAGAAAATGG + Intergenic
1010421477 6:75681286-75681308 CAGGAGTAACAGAGAGCAAAGGG - Intronic
1011648135 6:89480023-89480045 GAGGAGGAACTTAAAGAAAAGGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011940243 6:92833992-92834014 CATAAATAACTGAATGAAGAAGG + Intergenic
1014154415 6:118094190-118094212 CTTGAGTAAATGAGAGAAGATGG + Intronic
1014518397 6:122407165-122407187 CAGAAGTTAATGAAAGAAAATGG + Intronic
1015478025 6:133675319-133675341 AAGGAGGAAATGAAGGAAGAAGG + Intergenic
1015887429 6:137932260-137932282 CATGAATAAGTGAATGAAGATGG + Intergenic
1016162579 6:140899489-140899511 CAGAACTCACTGAAAGAAAATGG - Intergenic
1016482598 6:144497897-144497919 CAGGATATAGTGAAAGAAGAGGG + Intronic
1016802614 6:148182102-148182124 TAGGAGTTACAGACAGAAGATGG + Intergenic
1017592027 6:155988375-155988397 CAGAAGTTAATTAAAGAAGAAGG + Intergenic
1017940146 6:159045584-159045606 CAGGAGTTACAGAAAGGAGGAGG - Intergenic
1018483186 6:164212775-164212797 CAAGAGTAACCGAAAGCAAAGGG - Intergenic
1019566677 7:1685045-1685067 CAAGAGAAACTGAAAGAATCTGG - Intergenic
1020814024 7:12882243-12882265 CAGGTATTACAGAAAGAAGAGGG + Intergenic
1020981436 7:15074359-15074381 CAGGATTAACTTAAAGTATAAGG - Intergenic
1021434067 7:20594470-20594492 CAGGAGTAATTGAAGAAAAAGGG + Intergenic
1021807490 7:24371692-24371714 CAGAAGTATCAGAAAGATGATGG - Intergenic
1022636545 7:32141655-32141677 CAGGGGAAACTTAAAGAACAAGG + Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1027263146 7:76479221-76479243 CTGGAGTGACTGCAAGGAGAAGG + Intronic
1027314530 7:76977326-76977348 CTGGAGTGACTGCAAGGAGAAGG + Intergenic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1030953487 7:115821624-115821646 CAGGAGAAACTGAGATAAGCTGG - Intergenic
1032878041 7:136058803-136058825 CATGTGTAACTGAGAGAAAATGG + Intergenic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1034030277 7:147754803-147754825 CAGGAATAAATGAAAAAAAATGG + Intronic
1035997877 8:4569524-4569546 CAAGAGTAACTGAAACAGCATGG - Intronic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1038064429 8:23948598-23948620 CGGGAGTACCAGAAAGGAGAAGG - Intergenic
1038188675 8:25298930-25298952 CAGGATTGACTGAACAAAGAGGG - Exonic
1038266335 8:26042170-26042192 CAGGACGAAGTGAAAGAAGTTGG + Exonic
1038987826 8:32832738-32832760 CAGCAGGAACTGAAAGGAAATGG - Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039312391 8:36331225-36331247 AAGGAGTAATAGAAAGAATAGGG + Intergenic
1039534864 8:38300650-38300672 GAGGGGTAAGGGAAAGAAGAGGG - Intronic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1041307720 8:56480005-56480027 CACAAGTAACTGAAGGAGGATGG - Intergenic
1041852107 8:62403804-62403826 CTGGTGTAGCTGTAAGAAGAAGG + Intronic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1042435456 8:68759451-68759473 CAGGAGAAACTGAAACAATGAGG - Intronic
1042462324 8:69083922-69083944 CAGAAGTAAATGGAAGAAGGGGG - Intergenic
1043099382 8:76021300-76021322 CAGGAGGAAGAGGAAGAAGAGGG - Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1045226306 8:100249482-100249504 AAGTAGTAAGTGAAAGAAGTGGG + Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045899483 8:107260164-107260186 TAGGCTTAACTGAAAGCAGAAGG - Intronic
1046159420 8:110340927-110340949 GAGGAGTAATGGAAAGAACATGG + Intergenic
1046735292 8:117769657-117769679 CAGGAGGAAGAGAAAGAAGGGGG - Intergenic
1047071342 8:121347382-121347404 TAGGGGAGACTGAAAGAAGAGGG - Intergenic
1047325063 8:123828130-123828152 CAGGTCTAACTGCAAGGAGATGG - Intergenic
1047576575 8:126162237-126162259 CTGAAGTCAGTGAAAGAAGATGG + Intergenic
1048710120 8:137200629-137200651 TAGTAGTAAGTGAGAGAAGAAGG + Intergenic
1049040933 8:140111198-140111220 GAGGAGTAACTGAAAAAGAAAGG - Intronic
1051003864 9:12318053-12318075 TAGGAGTAACTGCCAGAATAAGG + Intergenic
1051804147 9:20972900-20972922 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804156 9:20973002-20973024 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804174 9:20973211-20973233 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804182 9:20973316-20973338 CAGCAGATGCTGAAAGAAGACGG - Intronic
1051910417 9:22148726-22148748 CAGGAGTGAGAGACAGAAGAGGG - Intergenic
1052985981 9:34488348-34488370 TCTGAGTTACTGAAAGAAGAAGG + Intronic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1058905323 9:109477971-109477993 CAGGAGTAACTGATAAACAAGGG + Intronic
1058978622 9:110148451-110148473 AAGGAGGAGATGAAAGAAGAAGG + Intronic
1059369809 9:113818933-113818955 GTGGAGTAACTGAAATAAGAGGG + Intergenic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1060086202 9:120704410-120704432 CAGAAGTAACTGAAAGTAAATGG - Intronic
1060603554 9:124894692-124894714 CTGGGGTAACTGAATGAATAGGG - Intronic
1060906442 9:127311299-127311321 CAGGGGTAACAAAAAGAAGGGGG + Intronic
1185505698 X:631132-631154 AAGGAGAAACTGAAAGAATTCGG + Exonic
1186082646 X:5950127-5950149 CAGGAGTAAGTGAGAGACAATGG + Intronic
1186631225 X:11351109-11351131 CAGGAGGAAATGAGAGAAGTGGG - Intronic
1187234443 X:17453922-17453944 GAACAGTAACTTAAAGAAGATGG + Intronic
1187276736 X:17822795-17822817 CATAAGTAACTAAAAGTAGACGG - Intronic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1187555864 X:20350534-20350556 TAGAATTAACTGAAAGGAGATGG - Intergenic
1187891264 X:23937133-23937155 CAGGAACAACTGAAGGGAGAGGG + Intronic
1187948626 X:24450752-24450774 AAGGAGGAAAGGAAAGAAGAAGG + Intergenic
1189134237 X:38532599-38532621 CTGGAATAACATAAAGAAGAAGG - Intronic
1189422797 X:40871570-40871592 CAGCAGTGACAGAAAGACGAAGG - Intergenic
1191023856 X:55892453-55892475 CAGGAGAAAGGGAAAGAAGGAGG + Intergenic
1192488060 X:71547879-71547901 GAGGGGTTAATGAAAGAAGATGG - Intronic
1192833002 X:74769724-74769746 CTGGAGTTACTGAAAGATGAGGG + Intronic
1193656678 X:84206748-84206770 CAGGAGAAAATAAAGGAAGAGGG - Intergenic
1194853217 X:98894846-98894868 CCAGAGTAACTGAAAATAGATGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195412890 X:104587872-104587894 CACAAGTAACTGTAGGAAGAAGG + Intronic
1195845172 X:109219795-109219817 CAGCAGGGACTGAGAGAAGAGGG + Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196614535 X:117752849-117752871 CAAGAATGACTGAAGGAAGAAGG + Intergenic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198784646 X:140273915-140273937 GGGGACTAACTGAAAGAATAAGG - Intergenic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199779463 X:151044920-151044942 CAGGAGGAAGAGACAGAAGAGGG - Intergenic
1202332456 Y:23769177-23769199 CAGGGGGAAGTGACAGAAGAAGG + Intergenic
1202538313 Y:25900886-25900908 CAGGGGGAAGTGACAGAAGAAGG - Intergenic