ID: 992139322

View in Genome Browser
Species Human (GRCh38)
Location 5:73780152-73780174
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139322_992139324 -9 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139324 5:73780166-73780188 CATCAACTTAGTTTCACCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133
992139322_992139330 28 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139330 5:73780203-73780225 CGTGTGCCAACCTGCAGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
992139322_992139323 -10 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139323 5:73780165-73780187 TCATCAACTTAGTTTCACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 107
992139322_992139331 29 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139322 Original CRISPR AAGTTGATGAGCCTTCCAAA AGG (reversed) Intronic