ID: 992139323

View in Genome Browser
Species Human (GRCh38)
Location 5:73780165-73780187
Sequence TCATCAACTTAGTTTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139322_992139323 -10 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139323 5:73780165-73780187 TCATCAACTTAGTTTCACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 107
992139319_992139323 15 Left 992139319 5:73780127-73780149 CCAAGAGGGCAACTTTTCGCTAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 992139323 5:73780165-73780187 TCATCAACTTAGTTTCACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 107
992139318_992139323 16 Left 992139318 5:73780126-73780148 CCCAAGAGGGCAACTTTTCGCTA 0: 1
1: 0
2: 1
3: 1
4: 58
Right 992139323 5:73780165-73780187 TCATCAACTTAGTTTCACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139323 Original CRISPR TCATCAACTTAGTTTCACCC AGG Intronic