ID: 992139324

View in Genome Browser
Species Human (GRCh38)
Location 5:73780166-73780188
Sequence CATCAACTTAGTTTCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139322_992139324 -9 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139324 5:73780166-73780188 CATCAACTTAGTTTCACCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133
992139318_992139324 17 Left 992139318 5:73780126-73780148 CCCAAGAGGGCAACTTTTCGCTA 0: 1
1: 0
2: 1
3: 1
4: 58
Right 992139324 5:73780166-73780188 CATCAACTTAGTTTCACCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133
992139319_992139324 16 Left 992139319 5:73780127-73780149 CCAAGAGGGCAACTTTTCGCTAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 992139324 5:73780166-73780188 CATCAACTTAGTTTCACCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139324 Original CRISPR CATCAACTTAGTTTCACCCA GGG Intronic