ID: 992139325

View in Genome Browser
Species Human (GRCh38)
Location 5:73780182-73780204
Sequence CGCTGGTGCAGGCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139325_992139335 15 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139325_992139331 -1 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171
992139325_992139330 -2 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139330 5:73780203-73780225 CGTGTGCCAACCTGCAGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
992139325_992139333 6 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139325 Original CRISPR CGCTGGTGCAGGCTGGCCCT GGG (reversed) Intronic