ID: 992139326

View in Genome Browser
Species Human (GRCh38)
Location 5:73780183-73780205
Sequence ACGCTGGTGCAGGCTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139326_992139330 -3 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139330 5:73780203-73780225 CGTGTGCCAACCTGCAGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
992139326_992139333 5 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311
992139326_992139335 14 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139326_992139331 -2 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139326 Original CRISPR ACGCTGGTGCAGGCTGGCCC TGG (reversed) Intronic