ID: 992139327

View in Genome Browser
Species Human (GRCh38)
Location 5:73780189-73780211
Sequence TGGCACACGCTGGTGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139327_992139339 27 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139339 5:73780239-73780261 CTGGATCTTCCTTGTGATCACGG 0: 1
1: 0
2: 0
3: 21
4: 190
992139327_992139333 -1 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311
992139327_992139335 8 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139327_992139331 -8 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171
992139327_992139330 -9 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139330 5:73780203-73780225 CGTGTGCCAACCTGCAGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139327 Original CRISPR TGGCACACGCTGGTGCAGGC TGG (reversed) Intronic