ID: 992139331

View in Genome Browser
Species Human (GRCh38)
Location 5:73780204-73780226
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139326_992139331 -2 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171
992139325_992139331 -1 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171
992139322_992139331 29 Left 992139322 5:73780152-73780174 CCTTTTGGAAGGCTCATCAACTT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171
992139327_992139331 -8 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type