ID: 992139333

View in Genome Browser
Species Human (GRCh38)
Location 5:73780211-73780233
Sequence AACCTGCAGCTCAGGGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139326_992139333 5 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311
992139328_992139333 -5 Left 992139328 5:73780193-73780215 CCTGCACCAGCGTGTGCCAACCT No data
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311
992139325_992139333 6 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311
992139327_992139333 -1 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139333 5:73780211-73780233 AACCTGCAGCTCAGGGCCCATGG 0: 1
1: 0
2: 6
3: 38
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139333 Original CRISPR AACCTGCAGCTCAGGGCCCA TGG Intronic