ID: 992139335

View in Genome Browser
Species Human (GRCh38)
Location 5:73780220-73780242
Sequence CTCAGGGCCCATGGTCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139327_992139335 8 Left 992139327 5:73780189-73780211 CCAGCCTGCACCAGCGTGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139328_992139335 4 Left 992139328 5:73780193-73780215 CCTGCACCAGCGTGTGCCAACCT No data
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139325_992139335 15 Left 992139325 5:73780182-73780204 CCCAGGGCCAGCCTGCACCAGCG 0: 1
1: 0
2: 1
3: 30
4: 252
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139329_992139335 -2 Left 992139329 5:73780199-73780221 CCAGCGTGTGCCAACCTGCAGCT No data
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data
992139326_992139335 14 Left 992139326 5:73780183-73780205 CCAGGGCCAGCCTGCACCAGCGT No data
Right 992139335 5:73780220-73780242 CTCAGGGCCCATGGTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139335 Original CRISPR CTCAGGGCCCATGGTCATCC TGG Intronic