ID: 992139669

View in Genome Browser
Species Human (GRCh38)
Location 5:73783083-73783105
Sequence AGGGGCTTACAGTTTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992139667_992139669 -9 Left 992139667 5:73783069-73783091 CCAAGTTGTTCTTAAGGGGCTTA 0: 1
1: 0
2: 0
3: 2
4: 95
Right 992139669 5:73783083-73783105 AGGGGCTTACAGTTTGAGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992139669 Original CRISPR AGGGGCTTACAGTTTGAGGT TGG Intronic
903836129 1:26204284-26204306 AGGAGCTAACAGTTTGAGTATGG + Intergenic
904882990 1:33714700-33714722 AAGGGCTTGCAGTTTGGCGTGGG - Exonic
906617843 1:47246942-47246964 AGGGGCTTAGAGGTTGAGTGAGG + Intergenic
908454287 1:64286972-64286994 AGGGCTTTACAGGATGAGGTTGG + Intergenic
909339486 1:74515652-74515674 AGGGGATCATGGTTTGAGGTGGG + Intronic
909502067 1:76345773-76345795 AGGGGCATACTGTCTGAGCTGGG - Intronic
910163076 1:84294599-84294621 AGGGGCCTGCAGTTTGATTTTGG - Intergenic
911163574 1:94705853-94705875 AAGGGCTGGCAGTTTGAAGTGGG - Intergenic
912176587 1:107165553-107165575 AGGAGCTTACAATCTGATGTGGG - Intronic
916429544 1:164713690-164713712 AGGGGCACACAGATTGAAGTAGG + Intronic
916526179 1:165611605-165611627 AGGGGCTTACAGTTTAGGAGAGG - Intergenic
917070332 1:171143342-171143364 AGATACATACAGTTTGAGGTAGG + Exonic
917731425 1:177878835-177878857 AGTGGCTGGCAGTTTGAAGTTGG - Intergenic
918374279 1:183893195-183893217 AGGGGATTACAGTCTCATGTGGG + Intronic
919365858 1:196659942-196659964 GGGAGCTTACATTTTGATGTGGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920368069 1:205458629-205458651 AGGGGGCTACAGTGTGGGGTTGG - Intergenic
921876867 1:220206996-220207018 TGGGGCTTACAGTTTGGGGATGG - Intronic
921985361 1:221306357-221306379 TGGAGCTTATAGTTTGAGATAGG + Intergenic
922558506 1:226550172-226550194 AGGGGTTTTCAGTTTGACTTTGG + Intronic
1064306053 10:14167639-14167661 GGGGGCTTAGAGTGTGAGGGAGG + Intronic
1065167930 10:23000165-23000187 TGGAGCTTACAGCTTTAGGTAGG - Intronic
1066170728 10:32841698-32841720 ATGGCCTTATAGTTTGAAGTTGG - Intronic
1067231415 10:44413646-44413668 AGGCCCTTGCAGTTTGGGGTTGG - Intergenic
1068111632 10:52687208-52687230 TGGGGATTACAATTTGAGATGGG - Intergenic
1076241293 10:128910064-128910086 TGGGGATTACAATTTGAGATGGG - Intergenic
1080304332 11:30820215-30820237 AGGGGATTACAGGTTTAGCTGGG + Intergenic
1081752952 11:45525046-45525068 AGGGGGTGACAATTTGGGGTGGG - Intergenic
1083838898 11:65291667-65291689 GGGTGCTTTCAGTTTGAGGTCGG + Intronic
1088372109 11:109102347-109102369 ATGGCCTTATAGTTTGAAGTTGG + Intergenic
1088634565 11:111807457-111807479 TGGGGGTTACACTTTGAGCTAGG - Intronic
1088932097 11:114362732-114362754 AGGGGCTTAAAGTCATAGGTGGG - Intergenic
1089731583 11:120522742-120522764 AGGGGATTTCAGTTTGGGGAAGG - Intronic
1092200155 12:6576790-6576812 AGGAGCTTTCAGTTTCAAGTAGG - Intronic
1096149808 12:49301829-49301851 AGGAATTTACAGTTTGGGGTGGG + Intergenic
1096493722 12:52027111-52027133 TGGGCCTTACAGTGGGAGGTGGG + Intronic
1098652118 12:72985787-72985809 AGGAGGGTAGAGTTTGAGGTGGG - Intergenic
1098950919 12:76639764-76639786 GTGAGCTTACAGTTAGAGGTAGG - Intergenic
1101577669 12:106013133-106013155 AGGGGTTCACGGTTTGGGGTTGG - Intergenic
1102670380 12:114613717-114613739 AGGGACTTAAAGCTGGAGGTAGG - Intergenic
1102948621 12:117012335-117012357 AGTGACTTAGAGTTGGAGGTGGG + Intronic
1103493020 12:121337833-121337855 AGGAGCTTACAGTCTGGGGTGGG - Intronic
1103564289 12:121807820-121807842 AGGGGCTTGCAGTAAGAGGAAGG - Intronic
1104914677 12:132258526-132258548 GGGGGCTCACAGTTTTAAGTAGG + Intronic
1107023962 13:35780704-35780726 CAGGGCTTACAGATTGTGGTAGG - Intronic
1108108656 13:47042966-47042988 AGGGGCATAAAGTTTCAGTTAGG + Intergenic
1114239507 14:20853442-20853464 AGGGACTTACAGTTCTATGTGGG + Intergenic
1119753704 14:77098763-77098785 CTGGGCTTCCGGTTTGAGGTCGG + Intronic
1123692359 15:22848963-22848985 AGGAGCTTACAGTCTGATGCAGG + Intronic
1125135933 15:36342708-36342730 TGGGGATTACAATTTGAGATGGG + Intergenic
1126993551 15:54412494-54412516 TAGGGATTACAGTTTGAGATGGG + Intronic
1129771249 15:78204760-78204782 AGAAGCTCACAGTTTGAGGCCGG - Intronic
1130982356 15:88821469-88821491 AGGGGCTCACTGTGTGAGGCAGG - Intronic
1131232925 15:90672647-90672669 AGGGGCATACAGATTTTGGTGGG - Intergenic
1131379926 15:91955073-91955095 AGTGGCTCACAGTGTGAGGATGG - Intronic
1131808033 15:96143406-96143428 AGGGGATTAGAGTTTGGAGTGGG - Intergenic
1136003324 16:27312633-27312655 AGGAGCTCTCAGTTTGAGGGTGG - Intergenic
1141395152 16:83698030-83698052 AGGGGTTTACAGTTTAGTGTGGG - Intronic
1143544520 17:7588519-7588541 GGGGGCTTCCAGTTTGCAGTGGG + Exonic
1143787686 17:9268371-9268393 CGGGGCTTAGAGTTTGATCTAGG + Intronic
1144189538 17:12831791-12831813 AGGGGCCTACAGTCAGATGTTGG + Intronic
1145915011 17:28567998-28568020 AGGGGATTGCAGTTTTAGATAGG - Intronic
1146447436 17:32943635-32943657 AGTGACTTACAGTGTGAGCTTGG + Exonic
1148468995 17:47881909-47881931 AGGAGCTTTCAGTCTGAGGGAGG + Intergenic
1148693535 17:49546139-49546161 GGGGCCTTACAGTTGGAGTTAGG + Intergenic
1149230488 17:54528416-54528438 AGGTCCTTACAGTATGGGGTTGG - Intergenic
1151249919 17:72826093-72826115 TGGGGATTACAGTTTGATATGGG - Intronic
1153596650 18:6732295-6732317 AGGTGCAAACAGGTTGAGGTTGG - Intronic
1154000807 18:10480867-10480889 AGGGTCTCACTGTTGGAGGTGGG - Intronic
1155278058 18:24208986-24209008 AGTGGCTGAAAGTTTGGGGTAGG + Intronic
1160963233 19:1734058-1734080 AGAGGCTCACAGTGTGAGGGTGG - Intergenic
1160992521 19:1865515-1865537 AGGGGCTTACAGTTGTAACTGGG + Intergenic
1163458860 19:17424568-17424590 AGGGGGTTTCAGGTTGAGATCGG + Intronic
1168132849 19:54332147-54332169 AGGGGCTTTGAGTGGGAGGTGGG - Intergenic
925016619 2:532048-532070 AGGGGCTTCCAATGTGAGATGGG - Intergenic
927719608 2:25374130-25374152 AGGGTCTTAGAGCTTAAGGTTGG - Intergenic
934162935 2:89269552-89269574 AGGGGCTTACAGATCAAGGGTGG + Intergenic
934204338 2:89912972-89912994 AGGGGCTTACAGATCAAGGGTGG - Intergenic
935739874 2:106138138-106138160 AGTGGCTTTCTGTTTGATGTCGG - Intronic
936432444 2:112476359-112476381 ATGGGCTTACAGATGGAGCTGGG - Intergenic
937377545 2:121347950-121347972 AGGGGTTTCCAGGTTGGGGTGGG - Intronic
937630808 2:124099103-124099125 TGGAGCTTACAGTGTGAGGATGG - Intronic
937903222 2:127038417-127038439 AGTGGCCTACAGGTTGAAGTTGG - Intergenic
938542526 2:132296325-132296347 AGGGGATTACAGTTAGAAGCAGG - Intergenic
940019696 2:149144135-149144157 AGGGGCTTATAGTATGATGGTGG + Intronic
941152493 2:161932185-161932207 ACTGGCTTACAGACTGAGGTTGG + Intronic
942571947 2:177323820-177323842 TGGGGCTGACAGATTGAGGGGGG - Intronic
942833596 2:180265731-180265753 AGGGGCTTAGAGTTTTACTTAGG + Intergenic
946238803 2:218341614-218341636 AGGGACTTACTGGGTGAGGTAGG - Exonic
1170431979 20:16284225-16284247 AGGTCCTTACAGTTTTAGATTGG - Intronic
1171871407 20:30529172-30529194 AGGGGATTACAGTTAGAAGCAGG - Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1174783458 20:53411456-53411478 AGGGGCTCACAGTAGGAGTTGGG - Intronic
1176134514 20:63515954-63515976 AGGGGCTTACAACTGCAGGTTGG + Intergenic
1177843657 21:26263080-26263102 AGGGGCTAAAAGTCTGAGCTGGG + Intergenic
1182447462 22:30397906-30397928 AGGGGGCAACAGTTTGAGGGCGG + Intronic
1183025608 22:35063952-35063974 AGGGACTTACATTCTGGGGTGGG - Intergenic
1183203962 22:36405683-36405705 AGGGGCTTACAGGGTTATGTTGG + Intergenic
1183473635 22:38023589-38023611 ATGGGCATACAGTTTCAGTTCGG - Intronic
1184059390 22:42073074-42073096 AGGGGCAGACAGTAGGAGGTGGG - Intergenic
1184894743 22:47400311-47400333 TGGGGATTACAGTTCGAGGTGGG + Intergenic
953495643 3:43384514-43384536 ATGGCCTTATAGTTTGAAGTCGG - Intronic
955415260 3:58685758-58685780 ACGGGCTTACGGTTTGAAGCTGG - Intergenic
957321259 3:78633393-78633415 AGGCACTTACAGACTGAGGTTGG + Intronic
959908317 3:111734532-111734554 AGGGGCTTCCAGTTTGTTTTAGG - Intronic
960160082 3:114340753-114340775 AGAGGCTTTCAGTTTTAGTTTGG - Intronic
960925600 3:122792912-122792934 AGGAGCGAATAGTTTGAGGTCGG - Intronic
963038123 3:141049951-141049973 GGGGGCTCACAGTTTTAGGAGGG + Intergenic
963375422 3:144457769-144457791 AGGGGCTTACAATTGAAGCTGGG + Intergenic
963565789 3:146928559-146928581 AGGAGCTGCCAGTTTCAGGTAGG + Intergenic
965333018 3:167400815-167400837 AGGGGCTTCCAGGTATAGGTAGG + Intergenic
966276818 3:178182714-178182736 TGGGACTTACAGTGGGAGGTTGG + Intergenic
966306683 3:178543979-178544001 AGAGACTTACAGTTTAAGGAGGG - Intronic
967279340 3:187806970-187806992 AGGGGCTTACAGGTTTGGGAAGG - Intergenic
968949409 4:3682841-3682863 AGGGGATTACAGGATGAGGTGGG + Intergenic
969438130 4:7200164-7200186 AGGGACTTTCGGTTTGGGGTGGG + Intronic
970728046 4:19070429-19070451 AGGGGTTCCCAGTTTAAGGTAGG + Intergenic
972567320 4:40281489-40281511 AGGGGCTTACAGTTGGAAGTGGG + Intergenic
973736064 4:53872646-53872668 TGGGGATTACAATTTGAGATGGG - Intronic
975706349 4:77115700-77115722 ATGGGATTACAATTTGATGTGGG + Intergenic
979125802 4:116970090-116970112 TGGGGATTACAATTTGAGATGGG - Intergenic
980678826 4:136127445-136127467 AGTGGTTTACAGTTTGACTTGGG - Intergenic
981606799 4:146548209-146548231 AGGGGCATAGAGTTTGATGAAGG + Intergenic
984505217 4:180609371-180609393 TGGGGCTTGCAATTTGAAGTGGG - Intergenic
986841303 5:11700456-11700478 AGGAGCTTACAATTTGCTGTGGG + Intronic
992139669 5:73783083-73783105 AGGGGCTTACAGTTTGAGGTTGG + Intronic
992721949 5:79569617-79569639 AGGGGCTTACAGGTTAAGGGTGG + Intergenic
996857111 5:128020565-128020587 AGTGTGTTACAGTTTGAGGCAGG - Intergenic
998418156 5:141960245-141960267 AGGGGCTGACAGTCGCAGGTGGG + Intronic
999155733 5:149456234-149456256 ACTGGCTTAGAGTTTGAAGTTGG + Intergenic
999269798 5:150290079-150290101 AGGGCCCCACAGTTGGAGGTGGG - Intronic
999661710 5:153871172-153871194 AGGGAATAACAGTTTTAGGTGGG + Intergenic
1003234642 6:4284659-4284681 AGGGGCTGGCAGTTGGAAGTTGG + Intergenic
1003264180 6:4551212-4551234 AGGGTCTTACTGTTTGGGGGAGG - Intergenic
1003559067 6:7166159-7166181 AGGGGCTGGCAGTTGGGGGTGGG - Intronic
1007739454 6:44002066-44002088 AGGTGCCTCCAGTTTGAGGGAGG + Exonic
1010515134 6:76763225-76763247 TGGGGATTACAATTTGAGATGGG - Intergenic
1011710109 6:90044449-90044471 AAGGGCATGCAGTTCGAGGTAGG + Intronic
1011933518 6:92743742-92743764 TGGAGATTACAGTTTGAAGTGGG - Intergenic
1013330043 6:109091469-109091491 TGGGGCAGACAGTTTGAGGGTGG - Intronic
1014195783 6:118556605-118556627 ATGGGCTAACAGGTTGAGATGGG + Intronic
1014275229 6:119380537-119380559 TGGGGATTACAGTTTGAGATGGG + Intergenic
1018962926 6:168461092-168461114 ATGGGCTTACAGTTCCATGTGGG + Intronic
1019261186 7:82768-82790 AGGGGCTGGCAGTGTGAGGCTGG - Intergenic
1021869259 7:24987436-24987458 AGGTGGTGCCAGTTTGAGGTTGG + Intergenic
1023355443 7:39362769-39362791 AGGGGGTTACTCTTTGATGTAGG + Intronic
1023514527 7:40987776-40987798 AGAAGCTTACAGTTTCTGGTGGG - Intergenic
1026452528 7:70541841-70541863 TAGGGATTAAAGTTTGAGGTAGG + Intronic
1026610499 7:71855451-71855473 TGGGGCTTCCAAGTTGAGGTGGG - Intronic
1031020789 7:116625563-116625585 AAGGGCTTACATCTTGAAGTGGG - Intergenic
1032054512 7:128673603-128673625 AGGTGGGAACAGTTTGAGGTGGG + Intronic
1032345653 7:131114000-131114022 TGGGGCTAACAGTTTGAGATGGG + Intronic
1035302386 7:157906083-157906105 AGTGGCTTCCAGTTTCAGGAAGG - Intronic
1036188284 8:6644766-6644788 AGGGACTTGAAATTTGAGGTAGG - Intergenic
1037187590 8:16082409-16082431 AGGGCCTTCCAGTCTGTGGTAGG + Intergenic
1037786268 8:21905195-21905217 AGGGGCCTACAGTGTGGAGTGGG - Intergenic
1039578107 8:38641863-38641885 TGGGGATTACAATTTGAAGTGGG - Intergenic
1039641008 8:39221513-39221535 ATGGGCTTACTGTTTGAATTTGG - Intronic
1041397275 8:57404245-57404267 TGGGGTTTACAATTTGAGATGGG + Intergenic
1041780921 8:61577840-61577862 TGGGGATTACAATTTGAGATGGG + Intronic
1042052673 8:64728448-64728470 AGGGGCTAACAGTGTGGGGAAGG - Intronic
1042438805 8:68800300-68800322 AGGTGCTTACTCTTTGAGATAGG - Intronic
1043556302 8:81434389-81434411 ATGGCCTTATAGTTTGAAGTGGG + Intergenic
1044713302 8:95077248-95077270 AGGGGCTTACAGTCTGGAGAGGG + Intronic
1045878307 8:107008748-107008770 ATGGCCTTATAGTTTGAAGTTGG - Intergenic
1046032680 8:108802735-108802757 TGGGGATTACAATTTGAGATGGG - Intergenic
1046857006 8:119043865-119043887 AAGGCCTTACAGTTAGAAGTAGG + Intronic
1048377520 8:133835518-133835540 AGGTGCTTACATTAGGAGGTCGG + Intergenic
1049610239 8:143551785-143551807 AGGGCCTTGCAGTGGGAGGTAGG - Intergenic
1059866465 9:118519984-118520006 TGGGGATTACAATTCGAGGTGGG + Intergenic
1060281389 9:122218151-122218173 AGGGGCTTCCAGTCTGGTGTTGG - Intronic
1187481752 X:19662838-19662860 ATGGGATTCAAGTTTGAGGTGGG + Intronic
1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG + Intronic
1188336203 X:28936502-28936524 AGGGGCTCACTTTTTGAGATAGG - Intronic
1190465998 X:50725486-50725508 TGGGGATTACAATTTGAGATGGG - Intronic
1190503128 X:51098663-51098685 AGGGTCTTACAGGTAGAGATGGG - Intergenic
1190586902 X:51954034-51954056 AGGGGGTTACAGTGTTAGGTAGG - Intergenic
1191975116 X:66863096-66863118 AGGGGCATAGAATTTGAGATGGG - Intergenic
1192188975 X:68979122-68979144 TGGGGCTTAAAGACTGAGGTGGG + Intergenic
1192596079 X:72409825-72409847 AGGAGCTTACAGTCTGATGGAGG - Intronic
1193761918 X:85477332-85477354 AGAGGCTTACATTTTTAAGTAGG - Intergenic
1195244558 X:102983751-102983773 AGGGCCTTACAGACTGAGGGTGG - Intergenic
1199987165 X:152960994-152961016 AGAGGCTTCCAGTTCGAGGCAGG + Intronic
1201781310 Y:17725478-17725500 ATAGGCTTACAGTTAGAGATTGG - Intergenic
1201820243 Y:18180512-18180534 ATAGGCTTACAGTTAGAGATTGG + Intergenic
1201855212 Y:18534126-18534148 ATAGGCTTACAGTTAGATGTTGG + Intergenic
1201878109 Y:18786258-18786280 ATAGGCTTACAGTTAGATGTTGG - Intronic