ID: 992140254

View in Genome Browser
Species Human (GRCh38)
Location 5:73789381-73789403
Sequence GCTGGGGTGTGGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1458
Summary {0: 1, 1: 1, 2: 5, 3: 146, 4: 1305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992140243_992140254 28 Left 992140243 5:73789330-73789352 CCAGAATAGGCAATTCTGTTGAG 0: 1
1: 0
2: 59
3: 328
4: 1140
Right 992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG 0: 1
1: 1
2: 5
3: 146
4: 1305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992140254 Original CRISPR GCTGGGGTGTGGAAGGAGGA TGG Intronic
900300200 1:1973304-1973326 GCAGGGGTCTGGGAAGAGGACGG + Intronic
900504893 1:3024991-3025013 GGTGGGGGGTGGAGGGAGGTGGG + Intergenic
900533811 1:3167575-3167597 GCAGGGGTGGGGTGGGAGGATGG - Intronic
900533831 1:3167635-3167657 GCAGGGGTGGGGTGGGAGGATGG - Intronic
900533851 1:3167695-3167717 GCAGGGGTGGGGTGGGAGGATGG - Intronic
900533871 1:3167755-3167777 GCAGGGGTGGGGTGGGAGGATGG - Intronic
900533891 1:3167815-3167837 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900533911 1:3167873-3167895 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900533931 1:3167931-3167953 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900533951 1:3167991-3168013 GCAGGGGTGGGGTGGGAGGATGG - Intronic
900533971 1:3168049-3168071 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900533991 1:3168109-3168131 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900534011 1:3168167-3168189 GCAGGGGTGGGGTGGGAGGATGG - Intronic
900534031 1:3168225-3168247 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900534051 1:3168283-3168305 GCAGGGGTGGGGCGGGAGGATGG - Intronic
900534072 1:3168346-3168368 GCAGGGGTGGGGCAGGAGGATGG - Intronic
900614737 1:3560465-3560487 CCAGGGGTGAGGAAGGAGGGAGG - Intronic
900679607 1:3909389-3909411 ACTTGTGTGTGGGAGGAGGAAGG - Intergenic
900733192 1:4276425-4276447 GGTGGGGTGTGTGGGGAGGAGGG + Intergenic
900934911 1:5759080-5759102 GCTGGCGGGAGGAAGGGGGAAGG - Intergenic
901160542 1:7173757-7173779 GTTGGGAGGTGCAAGGAGGAAGG + Intronic
901185314 1:7369082-7369104 CCTGTGGTGGGGGAGGAGGAGGG - Intronic
901220895 1:7583222-7583244 GGGGGTGTGTGGAAGGAGGGAGG + Intronic
901256705 1:7834972-7834994 TCTGTGTTGTGGCAGGAGGAAGG + Intronic
901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG + Intronic
901508390 1:9701022-9701044 GCTGCGGTGTGGAAGGACTGCGG - Intronic
901774986 1:11554370-11554392 TCTGGGGAGTGAAATGAGGAAGG - Intergenic
901838532 1:11939339-11939361 CCTGGGGTGGGGATGAAGGATGG + Intronic
902220440 1:14961121-14961143 TCTGGGGTGTGAATGGTGGATGG + Intronic
902304646 1:15526843-15526865 CCTGGGGAGGGGAAAGAGGAGGG - Exonic
902652261 1:17844559-17844581 GCTGGGAGGAGGAGGGAGGAGGG + Intergenic
902686677 1:18081833-18081855 GGTGGGGGGTGGAGAGAGGACGG + Intergenic
902701968 1:18178753-18178775 CCTGGGGTGGGGTAGGGGGAAGG - Intronic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
902808763 1:18876467-18876489 ACTGGGGTGGGCAGGGAGGAGGG + Exonic
902812193 1:18894630-18894652 TCTGCCCTGTGGAAGGAGGAGGG - Intronic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903184062 1:21619580-21619602 GCTGTGGGGTGGAGGGTGGAGGG + Intronic
903283222 1:22262051-22262073 GATGGGCTGTGGTGGGAGGATGG + Intergenic
903301297 1:22380438-22380460 GCTGTGGTGGGGGTGGAGGAAGG - Intergenic
903443098 1:23402928-23402950 GCTGAAATGTGGAAAGAGGAAGG + Intronic
903530479 1:24026476-24026498 GCTGTGGTGGGGATGGTGGACGG + Intergenic
903736471 1:25532838-25532860 GCTGGGGAGTGGAAAGACGAGGG + Intergenic
904065346 1:27745893-27745915 GCTGGGGAATGGAAGGAAAAAGG + Intronic
904328422 1:29742571-29742593 CATGGGGTGGGGGAGGAGGAGGG - Intergenic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
904557356 1:31373809-31373831 GGTGGGGTGGGGACGGAGGAGGG - Intronic
904575246 1:31501306-31501328 GCTGGGGGCTGGGAGGAGGCTGG + Intergenic
904585591 1:31578050-31578072 GATGGGGAGTGGGAGGAGCATGG - Intronic
904613095 1:31735893-31735915 GCTGGGGTGGGGGAGAAGAAGGG + Exonic
904631846 1:31848438-31848460 GCTGGAGTGGGGCTGGAGGATGG - Intergenic
904706135 1:32392437-32392459 GCTGGGGTGGGGGTGGAGGTGGG - Intronic
904768277 1:32867242-32867264 GTGGGGGTGTGGAAGCAGGAGGG + Intronic
904779793 1:32937180-32937202 GCTGGTGAGTGGAAGCAGCACGG - Exonic
905002850 1:34686722-34686744 GGTGGGGCGTGGGAGAAGGATGG - Intergenic
905176161 1:36136790-36136812 GTTGTGGGGTGGAGGGAGGAAGG - Exonic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905565639 1:38962334-38962356 GTTGGGGTGGGGAATGATGATGG - Intergenic
905906582 1:41622385-41622407 GCAGGGGTGGGGGAGGAAGAAGG + Intronic
906043193 1:42805427-42805449 GCTGGGATGTCCAAGGTGGAGGG - Intergenic
906290524 1:44616922-44616944 GTGGGGGTGTGGAAAAAGGAAGG - Intronic
906529442 1:46515075-46515097 GCTGGGGTCTGGAATTTGGAAGG + Intergenic
906686235 1:47765246-47765268 GCTGGGGTGGGGTGGGAGGTGGG - Exonic
906688394 1:47777216-47777238 GCTGGGGTGAGGGGAGAGGAGGG + Intronic
906694109 1:47812486-47812508 GCGGGGCTGAGGCAGGAGGATGG + Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906838926 1:49114755-49114777 CCTGAGGTGAGGAAGGAGAAGGG + Intronic
906904506 1:49875304-49875326 ACTGTGGTGTGGAGGGGGGAGGG - Intronic
906937748 1:50229202-50229224 GCTGAGATGTGGAATGAGCAGGG + Intergenic
907178921 1:52553111-52553133 GATGGGGAGGGGGAGGAGGAGGG + Intronic
907506539 1:54923167-54923189 GTTGGGGTGGGGAGGGAGGGAGG - Intergenic
907876640 1:58495265-58495287 GTTGTGGGGTGGGAGGAGGAGGG + Intronic
908089439 1:60670747-60670769 GAGGTGTTGTGGAAGGAGGAAGG + Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908732353 1:67239022-67239044 GAGGGAGTGAGGAAGGAGGATGG + Intronic
908994945 1:70140327-70140349 GCTGAGGTGTGGAAAATGGAAGG - Intronic
909170347 1:72285281-72285303 GGTTGGGGGTGGTAGGAGGAGGG + Intergenic
909310135 1:74135830-74135852 GGTGGAGTGTGGAAGGAGGGAGG + Intronic
909608312 1:77528768-77528790 GCTGGAGTGGGGAATGAGGATGG - Intronic
909698791 1:78496879-78496901 GATGGGGTGGGGGAGGGGGAGGG - Intronic
909986002 1:82161187-82161209 ACTGGGGAAGGGAAGGAGGAAGG - Intergenic
910431980 1:87167893-87167915 GGTGGGGTGTGGGAGGAGGTGGG + Intronic
910741632 1:90525474-90525496 GGTGGAGGGTGGGAGGAGGAAGG + Intergenic
910771921 1:90839569-90839591 GTGGGTGTGTGGGAGGAGGAGGG + Intergenic
911153341 1:94616298-94616320 GTTGGGGAGGGGAAGAAGGAAGG + Intergenic
911514116 1:98846252-98846274 GCTTGGGAGTGCAAGGAGGGAGG - Intergenic
911873456 1:103128956-103128978 GGTGGAGGGTGGAAGGAGGAAGG + Intergenic
912418683 1:109529093-109529115 GCTGGAGAGTGGAGGTAGGATGG + Intergenic
912520861 1:110243713-110243735 GCAGAGGAGGGGAAGGAGGAGGG + Intronic
912566159 1:110589009-110589031 GGAGGGGTGTGGAGGGAGGTGGG + Intergenic
912588120 1:110785561-110785583 GCTGGAGGGTAGAATGAGGAGGG + Intergenic
912620623 1:111153123-111153145 GCTGGGATGGGTAAGGAGGAGGG - Intronic
912925183 1:113906823-113906845 GATGGGAAGTGGAAGGAGGAAGG + Intronic
912935874 1:114003241-114003263 TCTGGGGCAGGGAAGGAGGAGGG + Intergenic
913199108 1:116482052-116482074 TCTGGGGTGTGAAGGGATGAGGG - Intergenic
913394181 1:118348117-118348139 GTTGGGGTGTGGGATGAGGGTGG + Intergenic
913530262 1:119729066-119729088 GATGGGGAGTGGAGGCAGGAGGG - Intronic
913530774 1:119732814-119732836 CCTGGGGGCTGGCAGGAGGAAGG - Intronic
913539556 1:119805804-119805826 GATGAAGTGAGGAAGGAGGAGGG - Intronic
914315306 1:146505680-146505702 GCTGAGGTGAGGCAGGAGAATGG - Intergenic
914499050 1:148227700-148227722 GCTGAGGTGAGGCAGGAGAATGG + Intergenic
914825844 1:151137698-151137720 GCTGGGGAGGGTAAGGAGGTGGG - Exonic
914835169 1:151200604-151200626 GCTGGAATGTGAAAGGTGGAAGG - Intronic
915073538 1:153291717-153291739 ACTGGGGTGAGGATGGGGGAAGG - Intergenic
915109338 1:153553164-153553186 GACGGGGTGTGGGAGGAGGACGG - Intergenic
915128693 1:153682638-153682660 GCTGTGGGGGGGAAGTAGGAGGG - Intronic
915168020 1:153959369-153959391 TCTGGGCTGGGGTAGGAGGAAGG - Exonic
915274014 1:154775717-154775739 GCTGCACTGGGGAAGGAGGAGGG - Intronic
915332945 1:155124982-155125004 GCTGGGGGCTGGCATGAGGAAGG + Intergenic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915464695 1:156089991-156090013 GCTGCGGTGAGGGAGGGGGAGGG + Intronic
915732876 1:158066685-158066707 GCTGGGGTGGGAAAGCAGAAAGG - Intronic
916005308 1:160654227-160654249 TCTGGGGTCTGGAAGGATGGAGG - Intergenic
916507334 1:165439933-165439955 GCTGTTATGTGGAAAGAGGAGGG + Intronic
916624851 1:166544405-166544427 GCTGGGGTTGGGAATGAGGCAGG - Intergenic
916684990 1:167136247-167136269 GCTGGGGTGGGGCAGAAGGGAGG + Intergenic
916787047 1:168093932-168093954 GCTGGGGTGGGGGTGGGGGATGG - Intronic
917020271 1:170579277-170579299 GTTAGGGTGAGGAAGAAGGAAGG + Intergenic
917241697 1:172955716-172955738 GATGGGGTGGGGAGGGAGGTTGG + Intergenic
917394717 1:174580626-174580648 GCTGTGGGGTGGGAGGAGGGGGG + Intronic
917499046 1:175569291-175569313 GAAGGGGTGGGGAAGAAGGAGGG - Intronic
917627668 1:176862434-176862456 TCTGTGCAGTGGAAGGAGGAGGG - Exonic
917735434 1:177915798-177915820 GTGGGGGTGAGGCAGGAGGAGGG - Intergenic
917856034 1:179100816-179100838 GCTGGCGTGTTGAAGGGGAAAGG - Exonic
917958663 1:180125595-180125617 GCGTGGCTGTGGAAAGAGGATGG - Intergenic
917979365 1:180259683-180259705 GCTGGGGTGGGGCAGGCGCAGGG + Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918445544 1:184613646-184613668 GCTGGGGTGTGGGGGTAGCAGGG - Intronic
918542913 1:185650658-185650680 GGTGGAGTTTGGAAGGAGGAAGG + Intergenic
918643875 1:186879984-186880006 GTTGTGGGGTGGGAGGAGGAGGG - Intronic
919323805 1:196080157-196080179 GGTGGGGAGTGGGAGGATGAGGG - Intergenic
919529780 1:198702453-198702475 GCTGTGGTGTGCAAGGCTGAGGG - Exonic
919608431 1:199715290-199715312 ACTGGGGGGTGGAGGGTGGAAGG + Intergenic
919861237 1:201740482-201740504 CCAGGCGGGTGGAAGGAGGAGGG + Intronic
920086655 1:203422398-203422420 CCTGGGGTGAGGACGGAGGAGGG - Intergenic
920303643 1:205004991-205005013 GATGGGGTAAGGCAGGAGGATGG + Intronic
920338546 1:205260678-205260700 GCTGGGGTGGGGGTGGGGGAAGG - Intronic
920422896 1:205847523-205847545 GTTTGGGTGTGTAAGGAGGTAGG + Intronic
920423560 1:205854214-205854236 GTTTGGGTGTGTAAGGAGGTAGG - Intergenic
920541848 1:206784671-206784693 GCGGGGGTGTGGAAGGGAGGTGG + Intergenic
920920121 1:210291966-210291988 GGTGGGGAGTGGGGGGAGGATGG + Intergenic
921177086 1:212604913-212604935 GCTGTGATGGGGAACGAGGATGG + Intronic
921221727 1:212978458-212978480 TTTGGGGCGTGGAGGGAGGAGGG - Intronic
922501589 1:226100811-226100833 GCTGGGCTGTGGAGGAAGAACGG + Intergenic
922559141 1:226555431-226555453 GCTGAGATGGGGAAAGAGGAGGG - Intronic
922765999 1:228157081-228157103 GCCGGGGGCTGGAGGGAGGATGG + Intronic
922784442 1:228276114-228276136 GCTGAGGGGAGGAGGGAGGAGGG + Intronic
923356662 1:233162914-233162936 GCTGGAGTGGGGAGGAAGGAAGG + Intronic
923544126 1:234911988-234912010 GCTTGTGTGTGGAAGGCGGAGGG + Intergenic
923647791 1:235841695-235841717 GCTGGGGCGGGGAAGCAGGAGGG + Intronic
924470200 1:244336652-244336674 GCTGAGGTGTGGTGGAAGGAGGG - Intergenic
924635775 1:245786200-245786222 GTTGGGGTGTGGACGGGGGGGGG + Intronic
1062797392 10:354753-354775 TCTGGGGTGCCGAAGGAGGCTGG + Intronic
1063259646 10:4372129-4372151 GCTGGGAGGTGGTATGAGGAAGG + Intergenic
1063691814 10:8295116-8295138 GCTGGGGAGTGGGAAGAAGAAGG + Intergenic
1064048828 10:12042872-12042894 GCTGGCGGGCGGAGGGAGGAGGG - Intronic
1064167870 10:13001796-13001818 GCTGGGGCGTGGGCGGGGGAGGG + Intronic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064365269 10:14701816-14701838 GCTGGCGTGTGAAAAGAGCAGGG + Intronic
1064770637 10:18718876-18718898 GATTGTGTGTGAAAGGAGGAAGG + Intergenic
1065204486 10:23344163-23344185 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1065322698 10:24523984-24524006 GCTTGGCAGTGAAAGGAGGAGGG + Intronic
1065363212 10:24908871-24908893 GCTGGGGTGAGAATGCAGGATGG + Intronic
1065818290 10:29501450-29501472 GGTGAGGAGTGGAGGGAGGAAGG + Intronic
1065857650 10:29843226-29843248 GCTGGGCTCTGTAAGGAGGAAGG - Intergenic
1065954621 10:30683051-30683073 GGTGAGGAGTGGAGGGAGGAAGG - Intergenic
1065982289 10:30911901-30911923 TCTGGCATTTGGAAGGAGGAGGG - Intronic
1066025128 10:31349069-31349091 GCTGGGGTGTAGAAGGGGTGGGG - Intronic
1066267773 10:33792802-33792824 GCTGGGCTGAGGCAGGAGAATGG + Intergenic
1067009875 10:42701018-42701040 GTTGTGGGGTGGAGGGAGGAGGG - Intergenic
1067081609 10:43215609-43215631 ACTGGGGTGGGGAAGGAGGTGGG + Intronic
1067361008 10:45578461-45578483 AATGGGATGTGGAGGGAGGAGGG + Intronic
1067698946 10:48555056-48555078 ATTGGGATGTGGCAGGAGGAAGG - Intronic
1067753464 10:48986601-48986623 GCTGGGGTGAGGATGGAGGCAGG + Intergenic
1067843853 10:49702928-49702950 GCAGGCATCTGGAAGGAGGAAGG + Intronic
1069622775 10:69848002-69848024 GCTGGGAAGAGGAAGGAGGTGGG - Intronic
1069706248 10:70460495-70460517 GTTGTGGTGTTGAGGGAGGAAGG - Intergenic
1069752057 10:70751317-70751339 GCTGGGGTATGGTAGGGGGTTGG - Intronic
1069901951 10:71711373-71711395 GCTGGCCTGGGGAAGAAGGATGG + Intronic
1069968286 10:72140756-72140778 GCTTGGCTGTGAAAGGAAGATGG + Intronic
1070545883 10:77452131-77452153 CCTGGCCTCTGGAAGGAGGAAGG + Intronic
1070565905 10:77603688-77603710 TGTGGGCTGTGGAAGGAGTAAGG - Intronic
1070609488 10:77923651-77923673 GCGGGGCTGAGGCAGGAGGATGG + Intronic
1070750398 10:78960837-78960859 GCTGGGATGTGGAAGGGAGGTGG - Intergenic
1071110167 10:82146684-82146706 GTTGGGGTATGGAAGGAGGTGGG + Intronic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1072056891 10:91767004-91767026 GCAGGGGTGGGGACGGAGGCGGG + Intergenic
1072068506 10:91893824-91893846 GGTGGAGAGTGGGAGGAGGAAGG - Intergenic
1072203017 10:93177960-93177982 GCAGGGGTGTGGCAGAAGGCAGG + Intergenic
1072321818 10:94257767-94257789 GTTGTGGGGTGGAGGGAGGAGGG + Intronic
1072493101 10:95928133-95928155 ACTGGGAGGTGGAAGTAGGAAGG - Intronic
1072513196 10:96149569-96149591 GCTTGTGGGAGGAAGGAGGAAGG - Intronic
1072786735 10:98288396-98288418 ACTTGAGGGTGGAAGGAGGAGGG + Intergenic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073137534 10:101228272-101228294 GCTGGGGGGTGGCAGGAGAAGGG - Intronic
1073214658 10:101829703-101829725 GGTGGGGTCTGGATGGAGGTTGG - Intronic
1073255202 10:102146650-102146672 CCTGTGGTGGGGAGGGAGGATGG - Exonic
1073428524 10:103471186-103471208 GATAGGGTGTGGAGGAAGGAGGG - Intergenic
1074111039 10:110423062-110423084 GCTGGGTTTGGGAAGGAGGCTGG + Intergenic
1074164739 10:110865307-110865329 GCAGGGCTGAGGAAGGGGGATGG - Intergenic
1074230669 10:111531831-111531853 GATAGGGTGAGGGAGGAGGATGG - Intergenic
1075067586 10:119299953-119299975 CGTGGGGTGGGGAAGGGGGAGGG - Intronic
1075079101 10:119370955-119370977 GCGGGGGGGTGGAAGGAGGGGGG - Intronic
1075471373 10:122692676-122692698 GATGGCATGTGGAAGGAGGAAGG + Intergenic
1075520960 10:123143234-123143256 GCTGGGGAGCGGAGGAAGGATGG + Intergenic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075743657 10:124711311-124711333 GATGGGGCGTGGGAGCAGGAGGG + Intronic
1075809614 10:125215487-125215509 GCTGCAATGTGGAATGAGGATGG + Intergenic
1076200936 10:128557376-128557398 GCGGGGGTGGGGTGGGAGGAAGG - Intergenic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1076312540 10:129518562-129518584 GCTGGGGAGGGGGAGGGGGAAGG - Intronic
1076370536 10:129949997-129950019 GGTGGAGGGTGGAGGGAGGAGGG + Intronic
1076443032 10:130493227-130493249 GCAAGTGTGTGCAAGGAGGAGGG - Intergenic
1076597394 10:131632574-131632596 GGTGGAGGGTGGAAGGAGGAAGG + Intergenic
1076676071 10:132148472-132148494 CCTTGGGGGTGGATGGAGGACGG - Intronic
1076737939 10:132467077-132467099 GCTGGGGTGGGGAAGGAAGCAGG - Intergenic
1076776463 10:132700576-132700598 GCTGGAGGGAGGAAGGAGGAGGG + Intronic
1076844973 10:133065539-133065561 GGTGGGGGATGGATGGAGGATGG + Intergenic
1076845032 10:133065739-133065761 GGTGGGGGATGGATGGAGGATGG + Intergenic
1076888858 10:133274425-133274447 GGTGGGGGGTGGAAGGTGGAGGG + Intronic
1077090333 11:775492-775514 GCTGGGGTGTGGGAGTGGCATGG - Intronic
1077097792 11:806466-806488 GCTGGGAAATGGAAGGAAGAAGG - Intronic
1077545399 11:3167040-3167062 GCTGGGGTGGAGCAGGACGAGGG + Intergenic
1077556906 11:3230311-3230333 GCTGGGGTTTGGGGTGAGGAGGG + Intronic
1077647177 11:3935685-3935707 GCTGGAGCGTGGAAGAAGTATGG + Intronic
1077791442 11:5444729-5444751 GCTTGTGTGTGGTGGGAGGAGGG + Intronic
1078075829 11:8159517-8159539 ACTGAAGTGGGGAAGGAGGAAGG + Intronic
1078588918 11:12620813-12620835 GATTTGGTGTGGAAGGTGGATGG + Intergenic
1078647755 11:13157856-13157878 GTTGTGGGGTGGAGGGAGGAGGG - Intergenic
1078712424 11:13807148-13807170 TCCGGGGTGAGGAAGGGGGAGGG + Intergenic
1079138956 11:17794984-17795006 GCTGGGCAGTGGGAAGAGGAGGG + Intronic
1079640768 11:22802304-22802326 GTTGTGGGGTGGAGGGAGGAGGG + Intronic
1080709598 11:34734251-34734273 GCTGGAGAGAGGAAGGAGCATGG - Intergenic
1080949703 11:37017579-37017601 GGTGGGCTGAGGAAGGAGAATGG - Intergenic
1081489177 11:43554135-43554157 GTTGGGTTGAGGAGGGAGGAGGG + Intergenic
1081542287 11:44044621-44044643 GCTGGTGTGTGGCAAGAAGAAGG + Intergenic
1081624193 11:44637619-44637641 GCTGGGGAGGGTAGGGAGGAGGG + Intergenic
1081663892 11:44905279-44905301 GTTGGGGTGTGGATGGATGTAGG - Intronic
1082203115 11:49397910-49397932 GTTGAGGAGTGGGAGGAGGATGG - Intergenic
1082774847 11:57237005-57237027 GCTGGGGAGTGGAGAGAAGACGG + Exonic
1083149733 11:60784290-60784312 GCCGGGGTGGGGATGGGGGATGG - Intergenic
1083476339 11:62918088-62918110 GCTGAGGTGGGCAAGGAGGCTGG - Intronic
1083571654 11:63764669-63764691 GCTGGGGTGAGGAGCCAGGATGG - Intronic
1083849195 11:65355346-65355368 GCTGGGGGGTGGGAGGTGGGTGG - Intronic
1083925175 11:65801717-65801739 GCTGGGGTGTTGGGGGAGGGCGG - Intergenic
1084112301 11:67022326-67022348 TCTGGGGTGGGGGAGGAAGAGGG - Intronic
1084403220 11:68956624-68956646 GCTGGGGTGGGGGTGGAGGTGGG + Intergenic
1084493375 11:69490075-69490097 GCTGGGGTGTTGAGGGACCAAGG - Intergenic
1084636600 11:70397441-70397463 GCTGCTGTGTGGAAGATGGATGG - Intergenic
1084772842 11:71355437-71355459 GCTGGGGAGAAGGAGGAGGAGGG - Intergenic
1085500729 11:77020531-77020553 ACTGGAGCGTGAAAGGAGGAGGG - Exonic
1086070190 11:82791212-82791234 GCTGGGGTGTGGTGGGAGAGGGG - Intergenic
1086938226 11:92767372-92767394 ACTGGAGTGTTCAAGGAGGAGGG - Intronic
1087599278 11:100291601-100291623 ACTGTGGTGGGGAAGGGGGAGGG + Intronic
1087905838 11:103696166-103696188 GCTGGGGAGGGGAGGGAGGAGGG - Intergenic
1088204698 11:107378613-107378635 GTTGTGGGGTGGAGGGAGGAGGG + Intronic
1088447448 11:109947307-109947329 GTTGTGGGGTGGGAGGAGGAGGG - Intergenic
1088506855 11:110535411-110535433 GCGGGGGTGGGGATGGAGGGTGG + Intergenic
1088598733 11:111457723-111457745 GCTGTGGGAGGGAAGGAGGAGGG - Intronic
1088645662 11:111914129-111914151 GCTGGGATGGGGAGGGAGGGAGG + Intronic
1088658482 11:112024940-112024962 GCTGGGGTGGTGAAGGAGCCAGG - Exonic
1089113573 11:116075877-116075899 CCTGGGGTGTGGAAGTGGAAAGG + Intergenic
1089215008 11:116829950-116829972 TCTGGGGAGGGGAAAGAGGAGGG + Intronic
1089504346 11:118953610-118953632 GCTGGGGTGGGGAAGGTGGGGGG + Intronic
1089614428 11:119687255-119687277 TCTGGCGTGAGGAAGGAAGAGGG - Intronic
1089616238 11:119696432-119696454 CCTGGGGTGGGGTTGGAGGAGGG + Intronic
1089621954 11:119727623-119727645 GGTGGGGTGGGGACGGAGGCTGG - Intronic
1089732456 11:120527592-120527614 GCTGGGGGCTGGGAGGAAGACGG + Intronic
1089732886 11:120530380-120530402 GCTGGGGTGTGGGTGGGGGTAGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090403479 11:126463503-126463525 GCTGGGCTGTGGAAGGAAAAAGG + Intronic
1090691724 11:129190203-129190225 GCATGGGTGTGGAAGGGGAAGGG - Intronic
1090887588 11:130892902-130892924 GGTGGGGTGGGGAAGGGGGAAGG + Intronic
1090935909 11:131342078-131342100 GAGGGGGTGTGGAAGGAGCAGGG + Intergenic
1090968145 11:131616258-131616280 TCTTGGGTGAGGAAGGAGAAAGG - Intronic
1091108223 11:132942857-132942879 GCTGGGGAGAGGAGGGAAGAGGG - Intronic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091303270 11:134521476-134521498 GCCTGGGTGGGGAAGGTGGATGG - Intergenic
1091441266 12:512866-512888 GGTGGAATGTGGAAGGTGGAAGG - Intronic
1091474008 12:753856-753878 GCTGGGGCAGGGAAAGAGGAAGG - Exonic
1091556056 12:1574372-1574394 GCAGCGGTGTGGATGGAGGCTGG + Intronic
1091556097 12:1574494-1574516 GCAGCGGTGTGGATGGAGGCTGG + Intronic
1091584089 12:1806024-1806046 GCTGGGGTGTGGAGGGAGCAGGG + Intronic
1091773947 12:3172212-3172234 GCTGGGGTGGGGGCGGGGGAAGG - Intronic
1092045800 12:5431350-5431372 GCTTGAGTGTGGAAGGGAGAGGG - Intergenic
1092049706 12:5459457-5459479 GCTGGGGTGTGAAGGGAAGGAGG - Intronic
1092145880 12:6214449-6214471 GGGGGGCTGAGGAAGGAGGATGG - Intronic
1092171615 12:6376827-6376849 GCTGGCTTGTGGAGGGAGGCAGG - Intronic
1092246815 12:6868358-6868380 GGTGGAGGGAGGAAGGAGGATGG - Intronic
1092254230 12:6917458-6917480 GCAGGGGTGGGGAGGGAGGAGGG + Intronic
1092370881 12:7915914-7915936 GCGGGGGGGGGGAAGGGGGAGGG - Intergenic
1092477196 12:8829334-8829356 GCATGTGTGAGGAAGGAGGAGGG + Intronic
1092658224 12:10710089-10710111 GCTGGGGAGGAGGAGGAGGAAGG - Exonic
1092825600 12:12395821-12395843 GCTGGGGTGGGGATAGTGGAAGG + Intronic
1092826141 12:12400750-12400772 CCTGTGGAGTGGGAGGAGGAGGG - Intronic
1093088561 12:14893975-14893997 GCTGGGGTGAGGGACTAGGAAGG + Intronic
1093184275 12:16002132-16002154 GCTGTTGTGGGGAAGGGGGAGGG - Intronic
1093322830 12:17735835-17735857 GCTGTGGGGTGGAGGGAGGGGGG + Intergenic
1093846397 12:23977296-23977318 GCTGGGAGGTGGAAGGGTGATGG - Intergenic
1094147413 12:27244584-27244606 GCCGGGGAGTGGAAGGAGAAAGG - Intronic
1094809442 12:34123556-34123578 ACTGGGGTGGGGAGGGGGGAGGG - Intergenic
1095042194 12:37455552-37455574 GCTGGGGTGGGGACAGAGTAGGG - Intergenic
1095614305 12:44170290-44170312 GCTGGGGGGTGGGGGGAGGGGGG + Intronic
1095894740 12:47268849-47268871 GCTGAGGTGGGGAAGAAAGATGG - Intergenic
1096110036 12:49023118-49023140 GGTGGGGTGTGGAGGGAGATGGG + Intronic
1096118292 12:49069330-49069352 GATGGGGTGGGGAAGGCGGCGGG - Intronic
1096134058 12:49185119-49185141 GTTGGGGAGGGGATGGAGGAAGG - Exonic
1096198054 12:49661809-49661831 GCAGTGGTGTGGAAGTAGGCAGG - Intronic
1096230549 12:49894463-49894485 GCTGGGCTGTGGGTGGGGGAGGG + Intronic
1096242822 12:49968355-49968377 GAAGGGGAGGGGAAGGAGGAAGG - Intronic
1096475302 12:51905988-51906010 GGTGGGGCGGGGCAGGAGGAGGG + Intergenic
1096635081 12:52953017-52953039 ATTGGGGTGTAGAAGGAAGAGGG + Intergenic
1096675705 12:53224720-53224742 GCAGGGAAGTGGCAGGAGGAGGG - Intronic
1096798318 12:54092330-54092352 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1096808001 12:54151982-54152004 GCAGAGGTGAGGAAGGATGAGGG + Intergenic
1096884011 12:54698900-54698922 GCGGGGGTGGGGAAGGGGGAGGG - Intergenic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097177407 12:57151421-57151443 GCTGTGTTGTGGAAGGAGTTGGG - Intronic
1098776517 12:74627028-74627050 GCTTGAGGGTGGAGGGAGGAGGG - Intergenic
1099351217 12:81571293-81571315 TCTTGGGAGTGGAAGGAAGAAGG + Intronic
1099637016 12:85226675-85226697 GCTGGGGGGTGGGGGGAGGGGGG - Intronic
1099714253 12:86270421-86270443 GCTAGGGGCTGGAAGGAGAAAGG - Intronic
1100032806 12:90213973-90213995 CCTGGGGTGAGGTAGGAGGTGGG - Intergenic
1100049000 12:90421633-90421655 GTGGTGGTGTGGAAGGTGGAAGG + Intergenic
1100362104 12:93888637-93888659 GGTGGGGTGTGGGATGGGGAGGG + Intronic
1100405834 12:94272338-94272360 GCTGGGATGGGGAATGAGGCTGG - Intronic
1100982770 12:100174885-100174907 GATGGAGGGTGGAAGTAGGAAGG - Intergenic
1101301704 12:103489665-103489687 GCTGCAGTGTGGATGGGGGAGGG - Intronic
1101436915 12:104671922-104671944 ACTGGGGTGTGGTTGGGGGATGG + Intronic
1101633798 12:106520764-106520786 GCAGGGGTGTGGATGAAGGATGG - Intronic
1102059770 12:109923643-109923665 GCAGGGGTGTGGTGGGAGGGAGG - Intronic
1102422809 12:112817380-112817402 GCTGGGGTGTGTGAGGATAAAGG - Intronic
1102543898 12:113641205-113641227 GCTGGGGTGGAGGTGGAGGAAGG - Intergenic
1102585696 12:113921389-113921411 GCTGGGGTGTGGGTGGAAGGTGG - Intronic
1102625007 12:114227900-114227922 GCTGGGGTGAGGGTGAAGGATGG + Intergenic
1102768835 12:115455649-115455671 GCAGGGGGGTGGCAGGGGGAAGG - Intergenic
1102985579 12:117275486-117275508 GCTGGAGGCTGGGAGGAGGAGGG + Intronic
1103144099 12:118579299-118579321 GGTGGGGTGGGGTAGGGGGAGGG - Intergenic
1103147965 12:118611586-118611608 GCCGGGGAGGGGAAGGAGGGAGG + Intergenic
1103219441 12:119231505-119231527 CCTGGGGTGTGGAGGGAGTCAGG + Intergenic
1103415002 12:120737754-120737776 GCAGGGGTGTGGAGGGAGTGAGG + Intronic
1103527603 12:121578629-121578651 GGTGGGGTGGTGAGGGAGGAGGG - Intronic
1103632036 12:122269357-122269379 GCTGGGGTGGGGAAGTTGGTGGG - Intergenic
1103703126 12:122858280-122858302 GCTGGGGATGGGAAGGAGGCAGG - Intronic
1103741288 12:123093570-123093592 GCTGCCGAGTGGCAGGAGGAAGG - Intronic
1103913275 12:124363435-124363457 GCTGCGGGGTGGAAGGGGGGAGG + Intronic
1103978622 12:124720981-124721003 GCTGAGCTGTGGAAGGAACAAGG + Intergenic
1104016096 12:124963348-124963370 GCTGGGGCGGGGAAGAAGGGGGG + Intronic
1104060584 12:125264531-125264553 GCTGGAGTGTTGATGGGGGATGG + Intronic
1104182692 12:126398104-126398126 GCTTGGGTGTAGAAGGGAGATGG + Intergenic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104423111 12:128653253-128653275 GCTGGGGGCTGGGAGGAGGGGGG + Intronic
1104473794 12:129053682-129053704 GATCGGGACTGGAAGGAGGAAGG + Intergenic
1104980846 12:132572564-132572586 GCCGGGGTGTGGGAGCAGGGTGG - Exonic
1106070669 13:26407800-26407822 GCTGGGGTGGGGAGGCAGGCGGG - Intergenic
1106144591 13:27039891-27039913 GCTGAGGAATGGAAGGAGCATGG - Intergenic
1106217449 13:27715828-27715850 GCTGGGAGTTGGAAGGAAGATGG + Intergenic
1106589121 13:31084140-31084162 GCTGGGGTGAGGTAGGAGTAAGG + Intergenic
1106590124 13:31091626-31091648 GACTGGGTGTGGGAGGAGGAGGG - Intergenic
1106795465 13:33200507-33200529 GGTTAGGTGTGGAAGGAGCAGGG - Intronic
1107299298 13:38948344-38948366 GCAGGGCTGTGGAAGGTGGCAGG + Intergenic
1107440371 13:40421607-40421629 TCTGGGGGATGGAAGTAGGAAGG + Intergenic
1107598943 13:41992806-41992828 GCTGGGGGCAGGTAGGAGGAGGG + Intergenic
1107606828 13:42065715-42065737 ACTTGGGTGAGGAAGGAGGCCGG + Intronic
1107818992 13:44269336-44269358 CCTGGGGTGTGGACAGAGAAGGG + Intergenic
1107823749 13:44308930-44308952 ACTGGGGAGTGGAAGGATAAAGG - Intergenic
1108321055 13:49290997-49291019 TCTGGGGACTGGAAGGAAGACGG - Intronic
1108431590 13:50359127-50359149 GCTGGGGTGCGGGTGGGGGATGG + Intronic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1108891941 13:55272675-55272697 GTTGTGGGGTGGGAGGAGGAGGG - Intergenic
1108914273 13:55588607-55588629 GCTGGGGGAGAGAAGGAGGATGG + Intergenic
1109162828 13:58997353-58997375 GCTGGGGGGTGGGAGGAGGGGGG - Intergenic
1109747519 13:66646833-66646855 GCTGGGGCATGGAAGAAGGGTGG - Intronic
1109982120 13:69923071-69923093 TCTGGGGAGGGTAAGGAGGATGG - Intronic
1110004843 13:70253658-70253680 GCTGGGAGGTGGAAGCGGGATGG - Intergenic
1110257970 13:73453129-73453151 GTTGTGGGGTGGAGGGAGGAGGG - Intergenic
1110433681 13:75456068-75456090 ACTGGGCTGAGGTAGGAGGATGG - Intronic
1110994582 13:82090599-82090621 GGTGGGGAGGGGAAGGTGGAGGG - Intergenic
1111073057 13:83195059-83195081 TCTGGGGTGGGGAAGGGGAAAGG + Intergenic
1111294751 13:86264156-86264178 CCTTGTGTGTGGAAGGATGAGGG + Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1111627663 13:90810317-90810339 GCTGGGGAGTGGGAGGAGTGGGG - Intergenic
1111951614 13:94712849-94712871 GGTGGGGCGAGGAAGGAGGGTGG + Intergenic
1112289746 13:98135037-98135059 GCTGGGGAGTTGGAGGAGAATGG - Intergenic
1112683344 13:101793167-101793189 GCTGGGGGGTGGAAGGAATGGGG - Intronic
1112797032 13:103068282-103068304 GTTGGGGTGGGGAAGGAGGTGGG - Intergenic
1112811762 13:103226317-103226339 ACTGGGTGGTGGCAGGAGGATGG - Intergenic
1113654995 13:112062581-112062603 GGGGGTGTGTGGAAGGAGAACGG - Intergenic
1113767153 13:112888686-112888708 GCAGCGGTGAGGATGGAGGAAGG + Intergenic
1113854843 13:113437470-113437492 GCTTGGGAGAGGCAGGAGGACGG - Intronic
1114056116 14:18968031-18968053 GGTGGGATGTGGGAGGATGATGG + Intronic
1114106435 14:19433722-19433744 GGTGGGATGTGGGAGGATGATGG - Intronic
1114490057 14:23094936-23094958 GCTGGGGTGTCGGAGGAGAGCGG - Exonic
1114553987 14:23551112-23551134 ACAGGGGTGTGGGAGGAAGAGGG - Intronic
1114554067 14:23551460-23551482 GCTGGAGGGAGGGAGGAGGAGGG - Exonic
1114648103 14:24266889-24266911 CCTGGGGGGTGAAGGGAGGAAGG + Exonic
1114890428 14:26914895-26914917 TCTGGGGTGAGGATGGGGGATGG + Intergenic
1115016040 14:28615680-28615702 GGTGGAGGGTGGGAGGAGGAGGG - Intergenic
1115707175 14:36011312-36011334 GCTGGAGAGTGGAGGGAGAAGGG - Intergenic
1115735178 14:36320317-36320339 GCCGAGGTGTGGAAGGAGCCCGG - Intronic
1115754770 14:36519830-36519852 GGAGGGGAGGGGAAGGAGGAGGG + Intronic
1116240076 14:42329394-42329416 GCTGGGGTGGAGAGGCAGGAAGG - Intergenic
1116923850 14:50612261-50612283 ACTGGAGGGTGGCAGGAGGAGGG + Intronic
1117231699 14:53725557-53725579 GGAGGAGTGTGGAAGGAGGACGG - Intergenic
1117331171 14:54713327-54713349 GCTGGGGTGGGGATGGGAGATGG - Intronic
1117516028 14:56502140-56502162 GCTGGGGTGTGGAGGGTGGAGGG - Intronic
1118331373 14:64818393-64818415 GCAGGGGAGTGGAAGGAGGGAGG + Intronic
1118407562 14:65441939-65441961 GTGGGGTTGTGGGAGGAGGAGGG - Intronic
1118764506 14:68900791-68900813 GCTGGAGTGTCCAGGGAGGACGG + Intronic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118986354 14:70759076-70759098 GCTAGGGAGTAGAAGGGGGAAGG + Intronic
1119476395 14:74932513-74932535 GATTGGGTGTGGGAGGGGGAAGG + Intergenic
1119726034 14:76922331-76922353 GATGGAGGGTGGAAGGTGGAGGG + Intergenic
1119726757 14:76926113-76926135 GCTGGTGTGTGGAGCCAGGAGGG - Intergenic
1120034829 14:79684819-79684841 GATGGGGAGTGGGAGGAAGAGGG + Intronic
1120602147 14:86523986-86524008 TTTGGGGTGTGGGGGGAGGAGGG + Intergenic
1120788086 14:88554923-88554945 GGCGGGGGGTGGCAGGAGGACGG + Intergenic
1120797339 14:88649022-88649044 GGTGGGGGGTGGCGGGAGGAAGG - Intronic
1121001314 14:90453845-90453867 GCGGGGGTGCGGGGGGAGGATGG + Intergenic
1121005392 14:90487376-90487398 GCCGAGGTCTGGCAGGAGGAGGG + Intergenic
1121048802 14:90806502-90806524 TCTTGTGTGTGGAAGTAGGATGG - Intronic
1121192821 14:92045041-92045063 GCTGGTGTCTGGAACGAGGTTGG + Exonic
1121217468 14:92259588-92259610 ACTGGGGTGGGGCAGGAGCAAGG + Intergenic
1121623183 14:95364415-95364437 CCTGGGGTGTGGGGGGAGGAGGG + Intergenic
1122123140 14:99565260-99565282 GCAGGGGTGGTGGAGGAGGAGGG - Intronic
1122137734 14:99644682-99644704 GTAGGGGTGGGGAGGGAGGACGG - Intergenic
1122179874 14:99947130-99947152 GTTGGGGTGTGGAGAGAGAAAGG + Intergenic
1122227345 14:100287403-100287425 TCTGGGGTGGGAAAGGGGGAGGG - Intergenic
1122266301 14:100548503-100548525 CCTGGGGTGTGGCTGGAGAAGGG - Intronic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122606378 14:102949360-102949382 GCTGGTGTGTGGAAGAAGTCTGG - Intronic
1122647936 14:103207392-103207414 GAAGGGGAGGGGAAGGAGGAAGG - Intergenic
1122825950 14:104370544-104370566 GCTGGGGCCTGGAGGGAGCAGGG - Intergenic
1202922290 14_KI270723v1_random:36439-36461 GCTGGGGTGTTGCAGGGGCACGG - Intergenic
1202940718 14_KI270725v1_random:143277-143299 GCTGGGGTGGGGACAGAGTAGGG - Intergenic
1123470032 15:20543251-20543273 GCTGGAGGGTGGAAGTAGGAAGG - Intergenic
1123648023 15:22457446-22457468 GCTGGAGGGTGGAAGTAGGAAGG + Intergenic
1123721333 15:23064320-23064342 GCAGTGGTGTGGAAGGGGCAGGG - Intergenic
1123730326 15:23138247-23138269 GCTGGAGGGTGGAAGTAGGAAGG - Intergenic
1123748464 15:23335665-23335687 GCTGGAGGGTGGAAGTAGGAAGG - Intergenic
1124216723 15:27813313-27813335 GCTGGGGTCAGGAGGGTGGAGGG - Intronic
1124280842 15:28359542-28359564 GCTGGAGGGTGGAAGTAGGAAGG - Intergenic
1124301862 15:28552083-28552105 GCTGGAGGGTGGAAGTAGGAAGG + Intergenic
1124355967 15:28995046-28995068 GCTGGGGTGGAACAGGAGGAGGG - Intronic
1124377881 15:29140146-29140168 ACTTGGGTGTGGAAGGCTGAAGG - Intronic
1124378493 15:29144038-29144060 GCCATGGTGTGGGAGGAGGAGGG + Intronic
1124402995 15:29366582-29366604 GCTGGGGTGTGGGAAGAGAATGG - Intronic
1124460266 15:29883528-29883550 GTTTGTGTGTGGAAGGAGGTAGG - Intronic
1124611548 15:31213167-31213189 GCTGGAGTTTACAAGGAGGAAGG + Intergenic
1124898129 15:33796468-33796490 CCTGGGGGGTGGCAGAAGGAAGG - Intronic
1125060104 15:35409186-35409208 GCTGGGGTTGGGAGGGAGGCAGG + Intronic
1125238971 15:37550738-37550760 CCTGTGGTCTTGAAGGAGGATGG - Intergenic
1125589600 15:40846014-40846036 TCTGGGGTGGGGGATGAGGAGGG + Intronic
1125719891 15:41840258-41840280 GCTGGGCTGAGGGAGGAGGAGGG + Intronic
1125728262 15:41879181-41879203 GCAGGGCAGTGGAATGAGGAAGG - Intronic
1125767401 15:42144753-42144775 GGTGGGGTCAGGGAGGAGGAGGG - Intronic
1126098313 15:45104612-45104634 GCTGGGGTAGGGAAGGGGAAGGG + Intronic
1126098618 15:45106495-45106517 GCTGGGCAGAGGAGGGAGGAGGG - Intronic
1126100541 15:45115887-45115909 GACGGGGTGAGGAAGGAGGTGGG + Intronic
1126559245 15:50025444-50025466 CCTGTGGAGGGGAAGGAGGATGG - Intronic
1126685684 15:51246884-51246906 GCTGGGGTGTGAAAGAGGGATGG - Intronic
1126951553 15:53887169-53887191 GTTTGTGTGTGGAAGGAGAAGGG + Intergenic
1127399981 15:58575789-58575811 GCTGGGGTGGGGAAGAAGGTGGG - Intergenic
1127477364 15:59347329-59347351 CCTGGGGTGTGGAGTGGGGATGG - Intronic
1127535332 15:59885074-59885096 GGTGGGGTGGGGAAGGGGAAGGG - Intergenic
1127664459 15:61131755-61131777 GCAGGGCTGGGGAAGGAGTAGGG + Intronic
1128126679 15:65198151-65198173 ACAGGGCTGTGGGAGGAGGAAGG - Exonic
1128227375 15:66011508-66011530 GTTGGGGTGTGGGAAGATGAGGG - Intronic
1128232725 15:66046874-66046896 GCTGGGGATTGGAGTGAGGAGGG - Intronic
1128290796 15:66476920-66476942 ACTTGGGTGTGGCAGGAGCAGGG + Intronic
1128442566 15:67725898-67725920 GGTGGGGTGGGGACAGAGGATGG + Intronic
1128678408 15:69628516-69628538 GCGGGGGTGGGGATGAAGGAAGG + Intergenic
1128727495 15:69998889-69998911 GCTGGGGAGTGGCAGGAAGTTGG - Intergenic
1128803653 15:70514319-70514341 CCTGGGGCATGGAAGGAGGCAGG - Intergenic
1128812745 15:70584614-70584636 GCTGGGGTGGGTGAGGAGGCAGG - Intergenic
1129832774 15:78681593-78681615 GCTGTGGTGGGGCAGAAGGATGG - Intronic
1130675815 15:85951105-85951127 GCTGGTGTGGGGAAGTAGGATGG - Intergenic
1130733288 15:86521819-86521841 GCTTGGGTGTGGAAGGACAATGG + Intronic
1130736938 15:86560281-86560303 GCGGGGGTGGGGAGGGGGGAGGG - Intronic
1130915822 15:88303739-88303761 GCTGGGGGGAGGAAGGAGAAAGG - Intergenic
1131075857 15:89494499-89494521 CCTGGGGTGTGAAAGGTGGGTGG + Intronic
1131187961 15:90291974-90291996 CATGGGGTGTGGAGGGAGGCGGG - Intronic
1131308006 15:91262600-91262622 GGTGGAGGGTGGGAGGAGGAAGG - Intronic
1132255423 15:100372876-100372898 GTTGGGGGGTGGAAGGTGGAGGG + Intergenic
1132408507 15:101559817-101559839 GCAGGGGAGTGGAGGGTGGAGGG - Intergenic
1132415822 15:101618221-101618243 GGTCGGGGGTGGAAGGAGGTGGG - Intergenic
1132422207 15:101680085-101680107 GCTGGGTTGGGGGAGGGGGATGG + Intronic
1132434024 15:101782007-101782029 GGTGGGGTGGGGAGGGAGGCGGG + Intergenic
1132672121 16:1106295-1106317 GCTGGGACACGGAAGGAGGAGGG - Intergenic
1132855515 16:2042954-2042976 GCTGGGGGGAGAAAGGGGGAGGG - Intronic
1132856554 16:2047670-2047692 GCTGGAGCGTGGGAGGAGGCGGG - Exonic
1132871446 16:2117398-2117420 GCTGGGGAGTCTCAGGAGGAAGG - Intronic
1132933760 16:2471215-2471237 GCTCGGGTCGGGAAGGAGGCAGG - Intergenic
1132939963 16:2501610-2501632 GCTGCTGGGTGGGAGGAGGAGGG + Exonic
1132989864 16:2787048-2787070 GCAGGGGTGACGATGGAGGACGG - Intronic
1133060655 16:3172315-3172337 TCTGGGGTTGGGAAGGAGAAGGG - Intergenic
1133084028 16:3347523-3347545 GTGGAGGTGTGGACGGAGGAGGG - Intergenic
1133175954 16:4014793-4014815 GCAGGGGTGGGGAAGCGGGAGGG - Intronic
1133286128 16:4691744-4691766 GCTGGCGTGTGGAGGCCGGACGG + Intergenic
1133319780 16:4905863-4905885 GGGGGGCTGTGGCAGGAGGATGG + Intronic
1133343618 16:5055394-5055416 CCTGGGGAGTGGGAGGAGGTGGG - Intronic
1133370588 16:5242983-5243005 GGTGGGGGGTGGAGGGTGGAGGG + Intergenic
1133464746 16:6018983-6019005 GCTGGCGAGGGGAAGGGGGAGGG + Intergenic
1133786294 16:8976052-8976074 GCTGGGGGGTGGGGGGAGGGGGG - Intergenic
1133817884 16:9212126-9212148 GCTGGGTGGAGGGAGGAGGAGGG + Intergenic
1134049083 16:11124414-11124436 ACTGGGAAGGGGAAGGAGGAAGG - Intronic
1134061158 16:11200475-11200497 GGTGGGGTGGGGAAGGGGAAAGG + Intergenic
1134400775 16:13907795-13907817 GATGGGATGTGAGAGGAGGAGGG - Intergenic
1134521082 16:14919496-14919518 GCTGGGGAGTCTCAGGAGGAGGG + Intronic
1134550489 16:15136476-15136498 GCTGGGGAGTCTCAGGAGGAGGG - Intronic
1134692152 16:16197942-16197964 GGTGGGAGGGGGAAGGAGGAGGG + Intronic
1134708758 16:16318147-16318169 GCTGGGGAGTCTCAGGAGGAGGG + Intergenic
1134715972 16:16358181-16358203 GCTGGGGAGTCTCAGGAGGAGGG + Intergenic
1134890827 16:17840412-17840434 TCTGGGGGGTGGGAGGATGATGG - Intergenic
1134950847 16:18350498-18350520 GCTGGGGAGTCTCAGGAGGAGGG - Intergenic
1134958784 16:18393978-18394000 GCTGGGGAGTCTCAGGAGGAGGG - Intergenic
1135123996 16:19791583-19791605 CCTTGTGTGTGGAAGGATGAGGG - Intronic
1135166282 16:20141911-20141933 GCAGGGGTCTGGGAGGAGGTGGG - Intergenic
1135343238 16:21666387-21666409 GCTGGGGTGTCCCAGCAGGAGGG + Intergenic
1135526907 16:23220212-23220234 CCTGGAGTAGGGAAGGAGGAAGG - Intergenic
1135668364 16:24354425-24354447 GCTGGGCTGAGGAGGGAGAATGG + Intronic
1135730887 16:24894306-24894328 CTTGGGGTGGGAAAGGAGGAGGG - Intronic
1136043785 16:27600195-27600217 AGTGGGGTGAGGAGGGAGGAGGG + Intronic
1136242280 16:28951576-28951598 ACTGGGGTGGTGAAGGAGGGTGG + Intronic
1136293671 16:29290216-29290238 GTTTTGGTGTGGGAGGAGGAAGG - Intergenic
1137054882 16:35740126-35740148 GCTGGTGTCTGGAATGAGAATGG + Intergenic
1137235018 16:46609391-46609413 GGTGGGGTGGGGAAGGTGCAAGG + Intronic
1137237316 16:46626351-46626373 GCTGGGGAGAGCAAGGAGGTGGG + Intergenic
1137576837 16:49605547-49605569 TCTGGGGAATGGAAGGAGGTGGG - Intronic
1137617459 16:49856151-49856173 GCGGGGGGTTGGGAGGAGGAGGG - Intronic
1137722875 16:50638118-50638140 TCTGAAGTGTGGCAGGAGGAGGG + Exonic
1137880274 16:52038928-52038950 GGTGGGGTGGGGAAGCAGGTAGG - Intronic
1138110768 16:54321980-54322002 GCCAGGGGCTGGAAGGAGGATGG + Intergenic
1138323893 16:56144758-56144780 GTTGGGGAGGCGAAGGAGGAAGG + Intergenic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138563514 16:57816146-57816168 GCTGGGGAGAGGAAAGGGGAGGG + Intronic
1138660362 16:58512876-58512898 GCAGGGCTGTGGACGGGGGAAGG + Exonic
1138741735 16:59318588-59318610 GGTGAGGGGTGGAAGGGGGATGG - Intergenic
1139335155 16:66226315-66226337 GCTGGGGTTTGGCGGGAGGGAGG + Intergenic
1139397254 16:66650050-66650072 GCTGGGATTTGGAAGAGGGAGGG + Intronic
1139507428 16:67406156-67406178 GCTGGTGTGTGGAAGTGGGGAGG - Intronic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1139933446 16:70548952-70548974 GCGGGGATGGGGAAGGAGAAGGG + Intronic
1139941784 16:70610803-70610825 GCTAGGGTGAGGAGGAAGGAGGG + Intronic
1140032151 16:71347433-71347455 GCTGGGGAGTGGCAGGCAGATGG - Intergenic
1140538163 16:75730198-75730220 GCTGGGGTGTGGGAGGAATGGGG - Intronic
1140780317 16:78290270-78290292 GGTGGGGGGGGGAACGAGGAGGG - Intronic
1141267694 16:82511775-82511797 GCTGTGGGGTGGGGGGAGGAGGG + Intergenic
1141287966 16:82690211-82690233 GCTGGGGTGGGGTTGGTGGAGGG + Intronic
1141407488 16:83807360-83807382 GTTTGGGTGTTGAAGGAGGTGGG - Intergenic
1141428139 16:83956831-83956853 GCTGGTGTGGGGAAGAAGGTAGG + Intronic
1141552835 16:84817622-84817644 GCTGGAGTGGGGATGGAGTAGGG + Intergenic
1141626860 16:85266042-85266064 GCTGGGCTCTGGAGTGAGGAAGG + Intergenic
1141935518 16:87235714-87235736 CCTGAGGCCTGGAAGGAGGAAGG + Intronic
1142001292 16:87665760-87665782 GATGGGCTGGGGAAGGAGGCTGG - Intronic
1142099554 16:88264222-88264244 GTTTCGGTGTGGGAGGAGGAAGG - Intergenic
1142179148 16:88658856-88658878 GCCGGGGTCTGGCAGGAGGAGGG - Intronic
1142195825 16:88738913-88738935 GCTTGAGTGAGGAAGTAGGAAGG - Intronic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1142227156 16:88883093-88883115 GGTGGGGTGTGGACCGAGGCTGG + Intronic
1142399552 16:89852126-89852148 TCTGGGGGGTGGGGGGAGGATGG - Intronic
1142399582 16:89852204-89852226 TCTGGGGGGTGGGGGGAGGATGG - Intronic
1142399643 16:89852360-89852382 TCTGGGGGGTGGGGGGAGGATGG - Intronic
1142399660 16:89852399-89852421 TCTGGGGGGTGGGGGGAGGATGG - Intronic
1142399690 16:89852477-89852499 TCTGGGGGGTGGGGGGAGGATGG - Intronic
1142399708 16:89852516-89852538 TCCGGGGGGTGGAGGGAGGATGG - Intronic
1142399740 16:89852594-89852616 TCTGGGGGGTGGAGGGAGGATGG - Intronic
1142433147 16:90041201-90041223 GCCAGGGTGAGGATGGAGGATGG + Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141744 16_KI270728v1_random:1771553-1771575 GCTGGGATGATGGAGGAGGAGGG - Intergenic
1142815706 17:2423539-2423561 GCCGGTGTGTGGGAGGATGATGG + Intronic
1143184859 17:5003976-5003998 GCTGGGGGATAAAAGGAGGAAGG - Exonic
1143362726 17:6384697-6384719 TGTGGGATGTGGAGGGAGGAAGG - Intergenic
1143646634 17:8234615-8234637 GCCAGAGTGGGGAAGGAGGAGGG + Exonic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1143868684 17:9942560-9942582 GCAGGGATGGGGTAGGAGGAGGG + Intronic
1144250945 17:13416162-13416184 GCTTGGGTTTGGATGGGGGAGGG - Intergenic
1144788377 17:17844254-17844276 GGTGGGGTGTGGCAGCGGGAAGG + Intronic
1144940170 17:18933330-18933352 GCCGGGCTGGGGCAGGAGGATGG + Intergenic
1145106718 17:20124013-20124035 GCTGGGGTGAGAGTGGAGGAAGG + Intronic
1145239661 17:21233081-21233103 GCTGGGATGTGGAAAAAGGATGG - Intergenic
1146210346 17:30937558-30937580 GCTAGGGTGAGTAGGGAGGAAGG + Intronic
1146255924 17:31391617-31391639 AGTGGGGAGGGGAAGGAGGAGGG - Exonic
1146577905 17:34011297-34011319 GCTGGGGGCAGGTAGGAGGAAGG - Intronic
1146634066 17:34491185-34491207 TCTGGGGTCTGGGAGGAGGAAGG + Intergenic
1146663956 17:34684190-34684212 GTTGGGGTGGGGATGGGGGAGGG - Intergenic
1146688423 17:34856901-34856923 GGTGGGGGGAGGATGGAGGATGG + Intergenic
1146734663 17:35228073-35228095 GCTGGGGTGGGGAGGTAGGAGGG + Intergenic
1147519188 17:41152995-41153017 GCAGGGGTGTAGGAGGGGGAAGG - Intergenic
1147630977 17:41931410-41931432 GCTGCTCTGTGGAAGGAGGCCGG - Intronic
1147697402 17:42366324-42366346 GATTAGGTGTGGCAGGAGGAGGG - Intronic
1147759794 17:42790077-42790099 CATGGGATGTGGAAGGGGGAAGG + Intronic
1147877136 17:43629641-43629663 GCTGGGCTGAGGCAGGAGAATGG - Intergenic
1148151491 17:45398933-45398955 GCTGGAGTGTGGGAGGTGGTGGG - Intronic
1148688838 17:49515179-49515201 GGTGAGGTGGGGAAGGAGAAGGG + Intergenic
1148759550 17:49992589-49992611 GGTGGGGAGTGGCAGGGGGAGGG - Intronic
1148797543 17:50204221-50204243 GATGGGGGGTGGGAGGAGGAGGG + Intergenic
1148849625 17:50548361-50548383 TCTGGGGTGTAGATGAAGGATGG - Exonic
1149126456 17:53240088-53240110 GATGGGGGGTGGCAGAAGGAAGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1149638381 17:58187561-58187583 GCTGGAGTGTGGAGGAAGGGTGG + Intergenic
1149856678 17:60088738-60088760 GCTGGCGTGGGGAGGGTGGAGGG + Intergenic
1149865451 17:60148934-60148956 GCTGGGGTGCGGGAGAGGGACGG - Intergenic
1149866281 17:60152694-60152716 GCAGAGGTCTTGAAGGAGGAAGG - Intronic
1150098789 17:62403420-62403442 GCTGCAGTGTGGAAAGTGGATGG - Intronic
1150433826 17:65139176-65139198 GCTGGGGAGGAGGAGGAGGATGG - Intronic
1150464651 17:65381823-65381845 GTTGGGTTGTGGAAGGAAGCTGG + Intergenic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1150631268 17:66882034-66882056 GCTGGGGAATGGAGGGAGGGAGG + Intronic
1151224009 17:72635117-72635139 GGTGGGCTGAGGAAGCAGGAGGG - Intergenic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151523966 17:74651052-74651074 CCTGGGGTCTGGAAGCAGGAGGG + Intergenic
1151694153 17:75705589-75705611 CCTGGGGTTTGGAAGGGAGAGGG - Intronic
1151727713 17:75894267-75894289 GCTAAGGCGTGGATGGAGGATGG - Intronic
1151732745 17:75920898-75920920 GCAGAGGTGTGGTGGGAGGATGG + Intronic
1151935373 17:77257822-77257844 GCTGCCGGGTGGAAGGTGGACGG + Intergenic
1152024220 17:77798237-77798259 GCTGAGCTGTGGATAGAGGAAGG + Intergenic
1152147219 17:78575620-78575642 GCTGGGGGCTGGAGGGAGAAAGG - Intronic
1152238001 17:79148412-79148434 GTTGGGGGGTGGAAGGGGCAGGG + Intronic
1152378692 17:79931147-79931169 GGTGGGGTGGGGGAGGCGGAGGG + Intergenic
1152423270 17:80205290-80205312 GGTGGGGGAGGGAAGGAGGAGGG - Intronic
1152432628 17:80257786-80257808 GCTGGGGCGGGGAAGCAGGTGGG + Intergenic
1152663461 17:81553522-81553544 GCTGGGGAGTGGGGAGAGGAGGG + Intronic
1152757822 17:82094300-82094322 GGTGGGGTCTGGCAGCAGGAAGG + Intronic
1152828470 17:82482321-82482343 GCAGGGGTGTTGAAGGATGAGGG + Intronic
1152931085 17:83110192-83110214 GCTGGCCTGGGGGAGGAGGAAGG + Intergenic
1153542504 18:6170779-6170801 GCTGGGGTGTGAAACCAGGGAGG + Intronic
1153935008 18:9913833-9913855 GAACGGGTGTGGAAGGAGGCGGG - Intergenic
1155091048 18:22511660-22511682 GTTGGAGGGTGGAAGGAGGGAGG - Intergenic
1155332297 18:24730572-24730594 GATGGGGTTGGGGAGGAGGAAGG + Intergenic
1155335526 18:24760723-24760745 GGTGGAGGGTGGAAGGAGGGAGG + Intergenic
1155336166 18:24767421-24767443 GCAAAGGTGTGGAAGGAGAACGG + Intergenic
1155584663 18:27351373-27351395 GCTAGAGAGTGGAAGGAGGGAGG + Intergenic
1155780446 18:29826024-29826046 AGTGGGTAGTGGAAGGAGGAGGG + Intergenic
1155989420 18:32264425-32264447 GGTGGGGTGTGGAAGGATGGAGG - Intronic
1156048738 18:32906783-32906805 ACTGGGGTGTGAAGGGAGGATGG - Intergenic
1156220933 18:35051272-35051294 GCAGGGGTCTGGCAGGAGAAGGG + Intronic
1156403855 18:36765123-36765145 GATGGGGGTTGGAGGGAGGAAGG + Intronic
1156419418 18:36934455-36934477 GTTGTGGGGTGGAGGGAGGAGGG - Intronic
1156579513 18:38358880-38358902 GCAGGGATGTGGAAGATGGATGG + Intergenic
1156684774 18:39631595-39631617 GGTGGGGTGTGTGAGGTGGAGGG - Intergenic
1156712927 18:39968491-39968513 TCTGGGTTGTGGAAGCAGGCAGG - Intergenic
1156911519 18:42416562-42416584 TATGGGGAGTGGAAGCAGGAGGG - Intergenic
1157279744 18:46338528-46338550 GTTGAGGTGGGGAAGGGGGAAGG + Intronic
1157342487 18:46791778-46791800 GCAGGGGTTGGGAGGGAGGAGGG - Intergenic
1157429109 18:47608843-47608865 GCTGAGGTGTATAAGGAAGAAGG + Intergenic
1157446915 18:47753130-47753152 GCTGGCATGTGGCAGGTGGAGGG - Intergenic
1157520641 18:48342789-48342811 CCTGGGGAGTGGAATGGGGAGGG + Intronic
1157601367 18:48894984-48895006 GCTGGGGGTTGGCAGGAGGTGGG - Intergenic
1157617058 18:48993203-48993225 GCTGGAATGTGGGTGGAGGAGGG - Intergenic
1158094800 18:53758417-53758439 GCTGGGGCGTGGGTGGGGGAGGG + Intergenic
1158669592 18:59463168-59463190 GCTAGGGTGGGAAAGGGGGAAGG - Intronic
1158779392 18:60628623-60628645 GTTGTGGGGTGGGAGGAGGAGGG - Intergenic
1158861101 18:61593181-61593203 GCTGATGTGTGGAAAGTGGATGG - Intergenic
1158963381 18:62604252-62604274 GATGGGCTGAGGGAGGAGGAGGG + Intergenic
1159178149 18:64865955-64865977 GCTGTGGGGTGGAGGGAGGGGGG - Intergenic
1160131759 18:76231570-76231592 GCTGGGGTGTGTCTGGAGGCGGG - Intergenic
1160451831 18:78971693-78971715 GCTTGGATGTGGAAGGAGAGTGG - Intergenic
1160500962 18:79400868-79400890 GCTGGGGGGAGGGAGGAGGATGG - Intronic
1160625531 18:80201783-80201805 GCTGGGGTGAAGGAGGCGGAGGG + Intronic
1160682467 19:418092-418114 GGTAGGGTGTGGACGGAGGAGGG - Intronic
1160703011 19:517519-517541 GCTGGGGGGTGCTGGGAGGACGG + Intronic
1160703067 19:517643-517665 GCTGGGGGGTGCTGGGAGGACGG + Intronic
1160703254 19:518103-518125 GCTGGGGGGTGCTGGGAGGAAGG + Intronic
1160858419 19:1227571-1227593 GCTGCAGGGTGGAAGGAAGACGG - Exonic
1161079262 19:2302545-2302567 GCTGGGGAGGGGAGGCAGGAAGG - Intronic
1161086136 19:2335637-2335659 GATGGGGTGGGAAAGGAGGCGGG - Intronic
1161103009 19:2430602-2430624 GCTTGGGCTTGGAGGGAGGAGGG - Exonic
1161403397 19:4078712-4078734 GGTGGGGTGGGGATGGAGGTGGG - Intergenic
1161403783 19:4080890-4080912 GGTGGGGAGGGGAAGGGGGAGGG + Intergenic
1161405785 19:4090482-4090504 GCAGGGGTGAGGCAGGAGGGTGG + Exonic
1161470739 19:4455739-4455761 CCGGGGGAGTGGGAGGAGGATGG + Intronic
1161522037 19:4730097-4730119 GGAGGGGTGTGGGTGGAGGAGGG - Intergenic
1161800569 19:6415088-6415110 GCCGGGGGTTGGAAGGAGAAAGG + Intronic
1161957164 19:7502677-7502699 GCTGGGGGGTGTGGGGAGGAGGG - Intronic
1161983132 19:7640878-7640900 GCTGGGGTGAGGCAGGAGTGGGG - Exonic
1161985785 19:7653085-7653107 GCTGGGGAAGGGAAGGAGGAAGG - Intergenic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162080886 19:8217019-8217041 GCTGGAGTCTGGAAGGAGCTGGG + Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162249445 19:9429991-9430013 GGGGGGGTGGGGTAGGAGGAGGG - Intronic
1162262726 19:9545846-9545868 GCTGGTGTCTGGAATGAGGTTGG - Intergenic
1162481124 19:10927762-10927784 GCTGGGGGCTGCAAGGAGGCAGG + Intronic
1162551681 19:11361640-11361662 GCTAGGATCTGGGAGGAGGAGGG - Intronic
1162821440 19:13225724-13225746 GGTAGGGTGGGGAAGGAGGTGGG + Intronic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1163182781 19:15615811-15615833 CCTGGTGAGTGGCAGGAGGATGG + Exonic
1163404369 19:17113198-17113220 GCTGGGCTGAGGGAGAAGGAAGG + Intronic
1163634535 19:18431978-18432000 CCTGGGGTGGGGCAGAAGGAAGG - Exonic
1164555641 19:29248787-29248809 GCTGGGGGATGGAGGCAGGAAGG + Intergenic
1164557817 19:29267068-29267090 GCTAGAGTGGGGAAGGAGGGAGG - Intergenic
1164588675 19:29494464-29494486 GGAGGGGTGGGGAGGGAGGAAGG + Intergenic
1164807409 19:31127716-31127738 GCTGGTGAGTGCAAGCAGGAGGG - Intergenic
1164899321 19:31904982-31905004 GAAGGGGTGGGGCAGGAGGAGGG + Intergenic
1164956398 19:32390515-32390537 GGTGGGGTGGGGTGGGAGGAGGG - Intergenic
1165712936 19:38025021-38025043 GCAGAGGTGGGGCAGGAGGAAGG - Intronic
1166218439 19:41351407-41351429 GCTGGGGTGAGGAGGGCGGGAGG + Intronic
1166376361 19:42329452-42329474 GTTGGGGTGAGGGAGGAGGCTGG + Intronic
1166380857 19:42354514-42354536 CCTGGGGTCTGGGAGGAGGAGGG - Intronic
1166679601 19:44758753-44758775 GCTGGGAGGTGGAAGCAGGCCGG - Exonic
1166997751 19:46727909-46727931 GCTGGGGTGTGCCAGGAGGCGGG + Exonic
1167001278 19:46746758-46746780 GTTTGGGTGTGGAAGGGGTAAGG - Exonic
1167066097 19:47187224-47187246 GCTGGGCTGGGGGAGGAGGTAGG - Intronic
1167145104 19:47676588-47676610 GGTGAGGGGGGGAAGGAGGAAGG - Intronic
1167259459 19:48450340-48450362 GCTGGGGTGTGGTCAGAGAAGGG + Exonic
1167428079 19:49439888-49439910 GCTGGGGGGTGGCAGCGGGAGGG - Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167621617 19:50563962-50563984 GATGGGGGGATGAAGGAGGAGGG + Intronic
1167686533 19:50960094-50960116 GATGGGGAGGGGGAGGAGGATGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167972356 19:53196579-53196601 CCTGGGGTGTGGAGCGAGGAGGG + Intergenic
1168231460 19:55034968-55034990 GCTGTGATGCGGCAGGAGGAGGG - Intronic
1168301911 19:55409714-55409736 CCTGGGGTGAGGGAGCAGGAAGG - Intergenic
1168322073 19:55516895-55516917 GCTGGGGTGCGGGAGGGGGCGGG - Intronic
1168355064 19:55695494-55695516 GGTGGGGTGGGAAAGGAAGAGGG - Intronic
1168675498 19:58275055-58275077 ACTGGGGTGGGGCAGGGGGAGGG + Intronic
1202631921 1_KI270706v1_random:7990-8012 GTTGTGGTGTGGAAGGAGGGGGG - Intergenic
925059168 2:878008-878030 GCAGGGGTTTGGGAGGAGGCGGG - Intergenic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925210180 2:2038806-2038828 GCTGGGGTGTGGGTTCAGGATGG - Intronic
925232862 2:2251486-2251508 GCTGGAGTGGGGCAGGAGGTGGG - Intronic
925617286 2:5755689-5755711 GTTGGGGTGTGGAGGGAGTGGGG + Intergenic
925662017 2:6212773-6212795 GCTGCGGTGCTGAAGGAGCATGG - Intergenic
925871809 2:8278232-8278254 GCTGGGGTGCGGGAGGAGGTGGG - Intergenic
926321434 2:11750850-11750872 GCTGGGGTGTGGTAGGGGTGGGG + Intronic
926661285 2:15469833-15469855 GCTGGGGGGTGGGGGGAGGGGGG + Intronic
926947674 2:18205968-18205990 GCAAGGTTGTGGGAGGAGGAAGG - Intronic
927490293 2:23516838-23516860 TCTGGGGTGAGGCAGGAGGCAGG + Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927714556 2:25343106-25343128 GCTGGGGCGCGCAAGGAGGCTGG - Intergenic
927846844 2:26476507-26476529 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927846856 2:26476531-26476553 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927846868 2:26476555-26476577 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927846892 2:26476603-26476625 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927846911 2:26476639-26476661 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927846937 2:26476687-26476709 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927846956 2:26476723-26476745 GAAGGGGTGGGGAAGGAGGTGGG - Intronic
927859549 2:26551943-26551965 TTTGGGGTGAGGAAGTAGGATGG + Intronic
927867082 2:26596299-26596321 TCTGGGGTGAGGATGCAGGATGG + Intronic
928174460 2:29024438-29024460 CCTGGGATGTGAAAGAAGGAGGG + Intronic
928458183 2:31443791-31443813 GGTGGAGGGTGGGAGGAGGAGGG - Intergenic
928670455 2:33598729-33598751 AGTGGGGTGGGGTAGGAGGAGGG + Intronic
929040945 2:37743876-37743898 GGTGGGGAGTGGAAGCAGAAGGG - Intergenic
929249552 2:39737906-39737928 GGTGGGAAGTGGAGGGAGGAGGG + Intronic
929429984 2:41878757-41878779 GTTGGGGGATGGGAGGAGGAGGG - Intergenic
929526360 2:42706960-42706982 GCTGGGGAGGGGAAGAGGGAGGG - Intronic
929546546 2:42858532-42858554 ACTTGGGTGTGGAGGGAGCAGGG + Intergenic
930553862 2:52870430-52870452 GGTGGGGTCTAGAAGGAGGTGGG + Intergenic
931663882 2:64596192-64596214 GGTGGGGTGGGGATGCAGGAGGG - Intergenic
931666751 2:64615268-64615290 GCTGGGCTGTGAAAGGCTGAAGG + Intergenic
932338317 2:70943558-70943580 GGTGGGGTGTGGAGAGAGGAAGG + Intronic
933365717 2:81351143-81351165 ACTGTGGTGGGGAAGGGGGAGGG - Intergenic
933538693 2:83610626-83610648 GCTGGGGTGGGGAAAAGGGATGG + Intergenic
933582945 2:84147847-84147869 CCTGGGGTGTGGGTGAAGGAAGG - Intergenic
933665309 2:84960086-84960108 GGAGGGGAGTGGAGGGAGGAGGG - Intergenic
933788206 2:85860944-85860966 GCTGGGGTGTGGGATGAGGTGGG - Intronic
933970433 2:87465522-87465544 GCTTTGGTGTGGAAGGAGCTGGG - Intergenic
934521628 2:95023724-95023746 GCTAGGGTGGGGAAGGAGAGGGG + Intergenic
934530920 2:95088032-95088054 GCGGGGGTGGGGGAAGAGGAGGG + Intronic
934662094 2:96148518-96148540 GGTGGGGGCTGGAAGGAGGAAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935213281 2:100956359-100956381 GCTGGAGGCTGGAGGGAGGAAGG - Intronic
935553736 2:104484838-104484860 TGTGGGGAGTGGAAGTAGGAAGG - Intergenic
935592483 2:104855376-104855398 GCGGGGGCGGGGAAGGAGGGGGG + Intergenic
935622695 2:105143666-105143688 GCGGGCGGGTGGAAGGAGGAAGG + Intergenic
936278601 2:111120301-111120323 CCTGCGGGGTGGCAGGAGGAGGG + Intronic
936285454 2:111177926-111177948 GGTGAGATGAGGAAGGAGGAGGG - Intergenic
936323350 2:111484974-111484996 GCTTTGGTGTGGAAGGAGCTGGG + Intergenic
936406560 2:112209886-112209908 CCTGGGGTGTTGGAGGATGAGGG + Intergenic
936573107 2:113632789-113632811 GCTGTGGAGTGAAAGGGGGAAGG + Intronic
936632039 2:114214362-114214384 CTTGGGGTGGGGAAGAAGGAAGG - Intergenic
936927701 2:117754597-117754619 GGTGGGCTGTGGTAAGAGGATGG + Intergenic
936935047 2:117831408-117831430 GCTGGGGGGTAGGAAGAGGATGG + Exonic
937044597 2:118844500-118844522 ACTTGGGTGTGGAAGCAGGTGGG - Intronic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937344069 2:121112467-121112489 GTTGGGGTTGGGGAGGAGGAGGG + Intergenic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
937870073 2:126780347-126780369 GCGGGGCTTTGGAAGAAGGAAGG - Intergenic
937905744 2:127052028-127052050 GCTGGGGTGGGCAAGCAGGAGGG + Intronic
937952703 2:127400993-127401015 CCAGGGGCGTGGAAGGAGGCAGG - Intergenic
938581004 2:132646370-132646392 TCTGGGCTGTGGGAGGAGTAAGG - Exonic
939180389 2:138796236-138796258 GCTTGGGCTTGGTAGGAGGAAGG + Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939360905 2:141171340-141171362 ACTGGGGTGGGGAAGAGGGAAGG - Intronic
939542457 2:143510594-143510616 GTTGAGGGGTGGAAGTAGGAAGG - Intronic
939763634 2:146217162-146217184 GCTGGGGTGTGGTGGGATGGAGG + Intergenic
940629970 2:156225784-156225806 GCTGGGGGGTGGTGGGATGAAGG + Intergenic
940642503 2:156361141-156361163 CCTGGGGTTTGGAAGGATGCAGG - Intergenic
940730778 2:157388510-157388532 GCTTGAGGGTGGAGGGAGGAAGG - Intergenic
940974277 2:159925963-159925985 GGTGGGGGGAGGAAGGATGAAGG + Intergenic
941494202 2:166180859-166180881 CCTGGGGCGGTGAAGGAGGAAGG + Intergenic
941518919 2:166513319-166513341 GGTGGGGTTTGGAAGGATGATGG - Intergenic
941924603 2:170882918-170882940 GGAGGGGAGGGGAAGGAGGAAGG + Intergenic
942086501 2:172449065-172449087 CCTGGGAAGTGAAAGGAGGAGGG + Intronic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942468731 2:176237460-176237482 GCTGGGGTGTGGAAGAAATGGGG - Intergenic
942663601 2:178292089-178292111 GGTGGGGGATGGGAGGAGGAGGG - Intronic
942965469 2:181888074-181888096 GCTGGGGTGGAGGAAGAGGAGGG + Intergenic
943506576 2:188768270-188768292 CATGGGGTGGGGAAGGGGGAGGG - Intronic
943938332 2:193956474-193956496 GGTTGGGGGTGGGAGGAGGAAGG - Intergenic
944344911 2:198651702-198651724 GCTAGGCTGGGGAAGGAAGATGG - Intergenic
944412098 2:199456107-199456129 GGTGGGGGGAGGAAGGGGGAGGG + Intronic
944605356 2:201347336-201347358 GCAGGGGTGTGGAGAGAGGAGGG - Intronic
944868452 2:203884964-203884986 GCTGGGGTGGGGGTGGAGGGGGG + Intergenic
945205852 2:207331390-207331412 CATAGGGTGTGGAAGGAGAAAGG - Intergenic
945959372 2:216116412-216116434 GTTGAGGTGTGGAAATAGGAGGG - Intronic
946154721 2:217799995-217800017 GCTGGGGTGGGGAAGGATGCTGG + Exonic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946304929 2:218851049-218851071 GCTGGGGAGTGGAGGGTGGTAGG + Intergenic
946307549 2:218864893-218864915 GGTGGGGTGTGAAAGGGGGTGGG + Intronic
946602881 2:221371439-221371461 GCTGGGGTGTGGATGAGGCAGGG - Intergenic
947573923 2:231257503-231257525 GCAGGGCTGAGGGAGGAGGAAGG - Intronic
947751670 2:232535785-232535807 TCTGGGGTCTGGAGGGAGGGAGG - Exonic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948384107 2:237571076-237571098 GCTGGGGTGGGGCAGCAGGCAGG - Intergenic
948491804 2:238318234-238318256 GCTGGGGTGGGGAAGGAGATGGG + Intergenic
948676787 2:239601540-239601562 GCCGGGGTGGGGAAGCAGGCAGG - Intergenic
948695716 2:239732178-239732200 GGTGGAGGGTGGAGGGAGGAAGG - Intergenic
948696906 2:239737367-239737389 GTTGGGGTGCGGCAGGAAGAGGG - Intergenic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948856660 2:240733409-240733431 GCTGGGCTGAGGAGGGAGCACGG - Intronic
1168839713 20:901808-901830 GCGGGGCTGAGGCAGGAGGATGG + Intronic
1168862521 20:1056055-1056077 GCTGGAGGGTGACAGGAGGATGG - Intergenic
1168882874 20:1223151-1223173 GCTGGGGGGTGGGGGGAGGGGGG + Intergenic
1168884812 20:1241617-1241639 GGAGGGGTATGGAAGGTGGAAGG + Intronic
1168958333 20:1850071-1850093 GGGGAGGTGGGGAAGGAGGATGG + Intergenic
1169073998 20:2750546-2750568 GCTGGGGCGGGGCGGGAGGATGG - Intronic
1169079389 20:2786706-2786728 GCTGGGGTGGTGGAGGAGAAAGG - Intergenic
1169225614 20:3854808-3854830 GCTTGGGTGAGGAACTAGGATGG - Intronic
1169667745 20:8057367-8057389 GTTGTGGGGTGGAAGGAGGGGGG - Intergenic
1169958486 20:11132114-11132136 TCAGGGGTTTGGAAGGAGGAGGG + Intergenic
1170367321 20:15611972-15611994 GCCGGGTGGTGGTAGGAGGATGG - Intronic
1171262872 20:23748648-23748670 GATGGGGTGGTGAGGGAGGAGGG - Intronic
1171272003 20:23824852-23824874 GATGGGGTGGTGAGGGAGGAGGG - Intronic
1171279398 20:23883343-23883365 GCAGGGAGGGGGAAGGAGGAAGG - Intergenic
1171361383 20:24588709-24588731 GTTGTGGTGTGAAAGGAAGAGGG + Intronic
1171423573 20:25034995-25035017 GCTGGGCTGAGGCAGGAGAATGG - Intronic
1171536628 20:25898624-25898646 GCTGGGGTGGGGACAGAGCAGGG - Intergenic
1171804478 20:29662533-29662555 GCTGGGGTGGGGACAGAGTAGGG + Intergenic
1171839568 20:30193889-30193911 GCTGGGGTGGGGACAGAGTAGGG - Intergenic
1172029233 20:31969662-31969684 ACTGAGGCTTGGAAGGAGGAGGG - Intronic
1172030001 20:31975109-31975131 CCTGGGGAGAGGAGGGAGGATGG + Intronic
1172120683 20:32596997-32597019 GGTGGGGTGGGGAAGGTGGCAGG - Intronic
1172325573 20:34031876-34031898 GCTGGGATGTGGCAGGTGGGGGG + Intronic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1172852977 20:37979968-37979990 ACTGTGTTGTGGAAGGAGCATGG - Intergenic
1172890318 20:38259903-38259925 GCTGGGGAGAGGGAAGAGGAAGG - Intronic
1172972250 20:38882153-38882175 GCTGGGCTGTAGAAAGAGCAAGG + Intronic
1173078109 20:39840000-39840022 GCTGGGTGATGGAAGGAAGAAGG - Intergenic
1173334399 20:42101119-42101141 GCTGGGGAGGGGAAGCTGGAAGG + Intronic
1173646876 20:44638884-44638906 GCAGGGGTGCGGAGGGAGGCAGG + Intronic
1173974252 20:47175156-47175178 GCTGGGTTGGGGAAGGAGACCGG - Intronic
1174107317 20:48171965-48171987 GCAGGGGTGGGGTAGGAGGTGGG - Intergenic
1174659661 20:52200812-52200834 GCTGAGGGGTGGAAGGGAGAAGG + Intronic
1174709818 20:52692654-52692676 GCTGGGGAGTGGAAAGAGAGAGG - Intergenic
1174870143 20:54174110-54174132 GAGGGGGGGTGGAAGGAGGATGG + Intergenic
1175120208 20:56710964-56710986 GATGGGGAGGGGAAGGAGGAGGG - Intergenic
1175229626 20:57465531-57465553 CTTGGGGTGTGGATGTAGGAAGG + Intergenic
1175309103 20:57999127-57999149 GCTTGGAAGTGGCAGGAGGAGGG - Intergenic
1175480124 20:59304822-59304844 GCTCGGGTCTGGAAGGACTAAGG - Intronic
1175524844 20:59626549-59626571 GCTTGGGTGTGGTAGGAACAAGG + Intronic
1175691196 20:61067143-61067165 GCTGGGGGTGGGAAGGAGCAGGG + Intergenic
1175934582 20:62509152-62509174 GGTGGAGGGTGGAAGGTGGAGGG - Intergenic
1175935071 20:62510474-62510496 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1175935098 20:62510550-62510572 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1176057893 20:63158414-63158436 GGTGGGGTGTGGATGGATGGTGG + Intergenic
1176057916 20:63158493-63158515 GGTGGGTTGTGGATGGTGGATGG + Intergenic
1176057942 20:63158580-63158602 GGTGGGCTGTGGATGGTGGATGG + Intergenic
1176061773 20:63175706-63175728 GCCGGGGTGGGTAAGGTGGAAGG - Intergenic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176217242 20:63954025-63954047 GCTGGGGGGAGGAGGGAGCAGGG + Intronic
1176274478 20:64255945-64255967 CCGGGGGTGGGGAAGGAGGAGGG - Intronic
1176286491 21:5021724-5021746 GGTGCGGTGGGGAAGGAGCAGGG + Intergenic
1176843483 21:13858875-13858897 GTTGGGGGGTGGAAGGAAAAGGG - Intergenic
1177167691 21:17621347-17621369 GATGGGGTGGGGACGGGGGAAGG + Intergenic
1177779449 21:25607291-25607313 GCGGGGCAGAGGAAGGAGGAGGG - Intronic
1178162698 21:29938381-29938403 GATGGGTTGGGAAAGGAGGAGGG + Intronic
1178308997 21:31514112-31514134 GGTGGGATGAGGCAGGAGGATGG - Intronic
1178311910 21:31536665-31536687 GCTGGGGTGAGCAAGGAGTGAGG + Intronic
1178417287 21:32413851-32413873 GCTGGGCTGGGGAAGGCTGAAGG - Intronic
1178923888 21:36759464-36759486 GCAGGAGTGTGGAAGGATGTAGG + Intronic
1178973576 21:37202480-37202502 GGTGGGGTGGGGAAGGAGAATGG - Exonic
1178982140 21:37273564-37273586 GGAGGGGTGGAGAAGGAGGAGGG + Intergenic
1178992216 21:37366253-37366275 GCGGGGGAGGGGGAGGAGGAGGG - Intronic
1179469035 21:41598216-41598238 CCTGGGGTATGACAGGAGGAAGG + Intergenic
1179623533 21:42633967-42633989 GCTGGGGCTTGGAGGGTGGATGG - Intergenic
1179658719 21:42861334-42861356 GGTGGGGTGGGGAGGGGGGAAGG + Intronic
1179870690 21:44241751-44241773 GGTGCGGTGGGGAAGGAGCAGGG - Intergenic
1180474608 22:15690734-15690756 GGTGGGATGTGGGAGGATGATGG + Intronic
1180623983 22:17181770-17181792 GCTGCGGGCTGGAAGGAGGCGGG + Intronic
1180847674 22:18993126-18993148 ACTGGGGTGTGGTGGAAGGATGG + Intergenic
1181536976 22:23551396-23551418 GATGAAGTGTGGATGGAGGATGG - Intergenic
1181566361 22:23741160-23741182 GCTGGGGTGTGCAGGAAGGATGG + Intergenic
1181589717 22:23876689-23876711 GCGGGGGGGTGGGAGGAGGAAGG - Intronic
1181613390 22:24034935-24034957 GCAGGGATGTGAATGGAGGATGG - Intronic
1181616904 22:24061191-24061213 GCTGGGGTGTGGAATGCAGCAGG - Intronic
1181637411 22:24180905-24180927 TCTGGAGGGAGGAAGGAGGAAGG - Intergenic
1181672495 22:24432297-24432319 GCTCGGATGTGGAAGGATGTGGG - Exonic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1181770069 22:25118844-25118866 CCTGGCGTCTGGAAGGAGCAGGG - Intronic
1182165903 22:28172618-28172640 TCTGGGGTGTGGGAGAAAGAGGG + Intronic
1182210149 22:28669145-28669167 ACTGTGGTGGGGTAGGAGGAGGG + Intronic
1182335049 22:29578494-29578516 GCTGGGGTGGGGATGGAGTGTGG - Intronic
1182477307 22:30583183-30583205 GCTGGGGAAGGGAAGAAGGAAGG + Intronic
1182516987 22:30864646-30864668 GCTGGGGAGTGGCAAGAGCAGGG - Intronic
1182657625 22:31903196-31903218 GGTTAGGTGTGGAAGGTGGAGGG - Intronic
1182657634 22:31903220-31903242 GGTTAGGTGTGGAAGGTGGAGGG - Intronic
1182657643 22:31903244-31903266 GTTTAGGTGTGGAAGGTGGAGGG - Intronic
1182657784 22:31903676-31903698 GCTTAGGTGTGGAAGGTGGAGGG - Intronic
1182740190 22:32561963-32561985 GCTGGGGTGTCGTAAGAGGAAGG - Intronic
1182808078 22:33092611-33092633 GGTGGGGTGGGGTAGGGGGAGGG - Intergenic
1182910748 22:33982120-33982142 TCTGGGGAATGGAAGGAGGCAGG - Intergenic
1183025596 22:35063929-35063951 GGTGGGGTGGGGTGGGAGGAAGG - Intergenic
1183398235 22:37585486-37585508 GGTGGGGCCTTGAAGGAGGAAGG + Intergenic
1183408109 22:37640216-37640238 GCTGGGCCGGGGAGGGAGGAGGG + Intronic
1183453885 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG + Intronic
1183674412 22:39291634-39291656 GCTGGGATGAGGAGGGAGCAGGG + Intergenic
1184129486 22:42509262-42509284 GCAGGGTCATGGAAGGAGGAAGG + Intergenic
1184139687 22:42571355-42571377 GCAGGGTCATGGAAGGAGGAAGG + Intronic
1184236848 22:43187313-43187335 GCGGGGGGCTGGGAGGAGGACGG - Intergenic
1184293336 22:43509452-43509474 GCTGGGGTATGGATGGACGGAGG - Intergenic
1184374751 22:44104703-44104725 GCTGGGGCAGTGAAGGAGGAGGG - Intronic
1184455424 22:44607259-44607281 CCGGTGGTGGGGAAGGAGGATGG + Intergenic
1184464788 22:44662487-44662509 CCAGGGGTGTGTAAGGAAGATGG - Intergenic
1184599357 22:45533368-45533390 ACTGGGGTTGGGAAAGAGGATGG + Intronic
1184610646 22:45601224-45601246 GGTGGGGTGAGGCAGGGGGACGG - Intergenic
1184747425 22:46464502-46464524 GCCAGGGTGCTGAAGGAGGAAGG - Intronic
1185100951 22:48840586-48840608 AGTGGGGTGTAGAGGGAGGAGGG - Intronic
1185109191 22:48891477-48891499 GCTCGGGAATGGAAGAAGGAGGG - Intergenic
1185137091 22:49079330-49079352 GATGGGGTGGGGCAGGAGGTTGG + Intergenic
1185276154 22:49950965-49950987 GGTGGGGAGTGGGAGGAGGGTGG - Intergenic
1185427078 22:50778085-50778107 GCTGTGGAGTGAAAGGGGGAAGG - Intronic
949223780 3:1669070-1669092 TCTGGGGTGTTGAAGGACAATGG + Intergenic
950247167 3:11431556-11431578 GCCAGGGGCTGGAAGGAGGAGGG - Intronic
950351397 3:12357243-12357265 GCTGGGGTAGGGCAGGAGGTAGG - Intronic
950548859 3:13654686-13654708 GCTGGGGGCTGGGAGCAGGACGG - Intergenic
950647263 3:14384569-14384591 GGTGGGGGGAGGCAGGAGGAAGG - Intergenic
950799991 3:15542858-15542880 GCTGAGATGTGGAAGGAAGGTGG + Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951691651 3:25402821-25402843 GTTGGGGTGGGGCATGAGGATGG + Intronic
951872740 3:27382965-27382987 GCTTGGGTGGGAAAGGAGCAAGG + Intronic
952529252 3:34246290-34246312 TCTGCAGTGTGGAATGAGGACGG + Intergenic
952668311 3:35935111-35935133 GATGGGGTGAGAAAGAAGGAAGG - Intergenic
952923512 3:38305487-38305509 GCAGGAGTGGGGAAGGAGGAAGG - Intronic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953147637 3:40293445-40293467 GGTGGGGTGTGGAATGGGGTGGG - Intergenic
953244046 3:41174834-41174856 GCAGGGGAGGGGAAGAAGGAGGG + Intergenic
953383267 3:42490134-42490156 ATTGGGGTGGGGAAGGAGCAAGG - Intronic
953681154 3:45039367-45039389 GCTGGGGTGAGGAAGGGTGAAGG - Intergenic
954296650 3:49678046-49678068 GCTGGGGTTAGGATGGTGGATGG - Intronic
954323164 3:49845673-49845695 GCTGGAGTGTGGAAGAAGTCAGG - Intronic
954396867 3:50297690-50297712 GCTGGGCTGTGCCAGGAGGGAGG + Intronic
954416530 3:50396033-50396055 GCTGGGCTGGGGAGAGAGGAGGG - Intronic
954686369 3:52372398-52372420 GCAGGGGTGAGGAAGGAGGGAGG - Intronic
954689100 3:52386441-52386463 CCTGGGGGCTGGAATGAGGAGGG - Intronic
954724637 3:52597162-52597184 GCTGGGGTATGGGAGAAGGGTGG + Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955044605 3:55348039-55348061 GACAGGGTGTGGAAGCAGGATGG - Intergenic
955349302 3:58182195-58182217 GGAGGAGGGTGGAAGGAGGAGGG + Intergenic
955512262 3:59693251-59693273 GCTGGGGTGAGGAAGGAATGAGG + Intergenic
956014430 3:64866757-64866779 AATGCGGTGTGGCAGGAGGAGGG - Intergenic
956860218 3:73315867-73315889 GCAGGGGGCTGGAGGGAGGAGGG - Intergenic
957338135 3:78858746-78858768 GGTGGGGTGGGGGAGGTGGACGG - Intronic
957341066 3:78897302-78897324 TGTGGGGTGTGGGTGGAGGATGG - Intronic
957660074 3:83138629-83138651 GTTGTGGTGTGGGAGGAGGGGGG + Intergenic
958746742 3:98144866-98144888 GCTGTGTGGTGGAAGGAGAATGG + Intergenic
960044456 3:113183209-113183231 TCTGGGGTGTGGAAGGAAACTGG + Intergenic
960052686 3:113252916-113252938 GCTTGGGTGTTGAAGGTAGAGGG + Intronic
960416466 3:117390882-117390904 GTTGGGGTGTGAACAGAGGAAGG + Intergenic
960699286 3:120425018-120425040 GCTAGGGCGTGGAAGGAAAAGGG + Intronic
960815771 3:121670760-121670782 GGGGGGGTGTGGGAGGAGGTGGG + Intronic
960951201 3:122999650-122999672 CCTGGGGAGGGGAAGGAGAAAGG - Intronic
961384229 3:126515553-126515575 GCTGGGGAGTGGAAGGGGGTAGG - Intronic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961750435 3:129091043-129091065 GCTGGGGAGAGCAAGGAGGTGGG + Exonic
961755077 3:129122329-129122351 GCCGGGGTGTTGATGGAGGAGGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961907224 3:130275533-130275555 ACAGGCGTTTGGAAGGAGGAGGG + Intergenic
962176511 3:133160944-133160966 GGAGGGGTGTGTAAGCAGGAGGG - Intronic
962237841 3:133723798-133723820 GGTGGGGTGGGGAAGGGGGAGGG - Intergenic
962265127 3:133939293-133939315 GCTGGGGAGTGGAGAGAGGGAGG + Intronic
963772661 3:149404648-149404670 CCTTGGATGTGTAAGGAGGAAGG + Intergenic
964291074 3:155180622-155180644 GAAAGGGTGTGGAGGGAGGAAGG + Exonic
965150881 3:164973322-164973344 GGTGGAGGGTGGAAGGAGGCAGG + Intergenic
965230917 3:166052006-166052028 CCTGGGATGTGGAAGTACGAGGG - Intergenic
965285342 3:166812022-166812044 GGAGGGATGTGGAGGGAGGAAGG + Intergenic
966022319 3:175230132-175230154 GCAGGTGTGTGGTAGGAGGCAGG - Intronic
966327128 3:178769390-178769412 GCTGGGGTGGGGTAAGAGGGGGG + Intronic
966332627 3:178831744-178831766 GCTTGAGTGTGGAGGGAGGAAGG + Intronic
967109155 3:186278121-186278143 GCTGTCTTGTGGCAGGAGGAAGG - Intronic
967142289 3:186571013-186571035 GCTGGGGGGTGGGAGGGGGTGGG + Intronic
967383496 3:188886147-188886169 GTTGTGGGGTGGAGGGAGGAGGG + Exonic
967435928 3:189445926-189445948 GTTGTGGGGTGGGAGGAGGAGGG + Intergenic
967888846 3:194351048-194351070 GCTGGGAAGAGGCAGGAGGAAGG - Intronic
968063715 3:195746535-195746557 GCTGGGGTGGGGGAAGAAGAAGG + Intergenic
968084892 3:195869850-195869872 GCTCGGCCGTGGAAGGAGGGAGG + Intronic
968231564 3:197007666-197007688 GCTGGGCTGTGGCAACAGGAAGG + Intronic
968248888 3:197186222-197186244 ACTGGGAGGTGGAAGGCGGAAGG + Intronic
968410488 4:386188-386210 CCTGAGGGGTGGAAGCAGGACGG - Intergenic
968481137 4:833549-833571 GAAGCGGGGTGGAAGGAGGAAGG + Intergenic
968539290 4:1155143-1155165 GCTGGGTTTAGGTAGGAGGAAGG - Intergenic
968567050 4:1318525-1318547 GCTGCTGTGTGGAAGAAGGCGGG + Intronic
968594224 4:1474055-1474077 GCTGTGGGGTGGAAGCAGGTGGG + Intergenic
968626694 4:1629131-1629153 GCTGGGAAGAGGAAGGAGCAGGG + Intronic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
968952052 4:3700328-3700350 GAAGGGGAGAGGAAGGAGGAGGG + Intergenic
969175956 4:5399299-5399321 GCAGAGGTGGGGAAGGAGGGTGG - Intronic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969285189 4:6198782-6198804 GCTGGGATGGGCAAGGAGGAGGG - Intronic
969587078 4:8100329-8100351 GCTGGGAAGTGGAAGAAGCAAGG - Intronic
969673093 4:8600541-8600563 GCTGTGATGAGGAAGCAGGAAGG + Intronic
969699904 4:8762259-8762281 GCTGGGGAGAGGAGTGAGGAGGG - Intergenic
969909607 4:10431534-10431556 GCTGGGGTGTGGGTGGGGGATGG + Intergenic
969929421 4:10615370-10615392 ACTTGGGATTGGAAGGAGGAAGG + Intronic
970817859 4:20179117-20179139 GCAGGGGTGGGGAGGGAGGCAGG + Intergenic
970860390 4:20696103-20696125 CCTGGGGGGAGGATGGAGGATGG - Intergenic
971676187 4:29632367-29632389 GCTGTAGTGTGGAAGATGGAAGG - Intergenic
971721284 4:30247780-30247802 GCTGGATTTTGGAAGGAGCAGGG - Intergenic
971828175 4:31654955-31654977 GTTGAGGTCTGGAAGGAGTATGG - Intergenic
972109292 4:35536253-35536275 CCTGGGGTGGGGAAGTGGGAGGG - Intergenic
972778653 4:42266242-42266264 GGTGGGGAGTGGAAGGTGGTGGG - Intergenic
973035820 4:45404908-45404930 ACTGGGATGGGTAAGGAGGAGGG + Intergenic
973184275 4:47306311-47306333 GGAGGGGTGGGGTAGGAGGAAGG + Intronic
973259526 4:48148077-48148099 GCTGGGCTGGTGAAGGGGGATGG + Intronic
973560001 4:52125786-52125808 GCGGGGGTGAGGCAGGAGGAGGG - Intergenic
973799119 4:54459179-54459201 GCTGGAGTATGGCAGGGGGAGGG + Intergenic
974330227 4:60468264-60468286 GTTGTGGGGTGGAAGGAGGGGGG + Intergenic
975156479 4:71078467-71078489 GCTGGAGTTTGGGAGGAGCATGG + Intergenic
975159559 4:71109957-71109979 GGATGGGGGTGGAAGGAGGATGG + Intergenic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975950198 4:79761407-79761429 GCTGGGGGGTGGGGGGAGGGGGG - Intergenic
975978118 4:80122178-80122200 GGTGGGGTGTGGGAGGAAGGAGG + Intronic
976239701 4:82942155-82942177 GGTGGGGACTGGAAGGATGATGG + Intronic
976258646 4:83124865-83124887 GGAGGGGTGTGGGGGGAGGAGGG + Intronic
976408427 4:84685355-84685377 GCTAGGGGGTGGGAGGAGCAAGG - Intronic
976538985 4:86251323-86251345 ACTGTGGTGGGGAGGGAGGAGGG - Intronic
976715333 4:88117213-88117235 GCTTGGGTGAGGTGGGAGGATGG + Intronic
978808261 4:112822639-112822661 GGAGGGGTGAGGTAGGAGGATGG + Intronic
979117640 4:116847906-116847928 CCTAGAGTGTGGAAGGAGGGAGG + Intergenic
980119115 4:128709524-128709546 GCTAGGCTGTGGGAGGAAGAAGG - Intergenic
980205552 4:129715634-129715656 CATGGGGTGGGGGAGGAGGAGGG - Intergenic
981699737 4:147595546-147595568 GGTGGTGTGTTGCAGGAGGATGG - Intergenic
981777437 4:148386115-148386137 CCTGGGGGCTGGGAGGAGGAGGG - Intronic
982092454 4:151892288-151892310 GGTGAGGGGTGGAAGGAGCAGGG + Intergenic
983162104 4:164429320-164429342 GCTGGAGTGGTTAAGGAGGAAGG - Intergenic
983542450 4:168927192-168927214 TCAGGGGTTTGGAAGGAGTAGGG + Intronic
984081959 4:175258021-175258043 GGTGGGGTGGGGAGGGGGGAGGG + Intergenic
984410227 4:179388625-179388647 GCTGGGTGTTTGAAGGAGGAAGG - Intergenic
984888531 4:184472879-184472901 GCGGGGGAGGGGAAGGAGGCGGG - Intronic
985780521 5:1868553-1868575 GCTGTGGTTTGCAGGGAGGACGG - Intergenic
985870725 5:2553961-2553983 GCAGGGGTGTGGGAGAAAGATGG - Intergenic
985944357 5:3165462-3165484 GCTGAGGAGTGAAGGGAGGAAGG + Intergenic
986773477 5:10994293-10994315 GCGGGGGCGGGGACGGAGGAAGG + Intronic
986773546 5:10994448-10994470 GCGGGGGCCGGGAAGGAGGAAGG + Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987049372 5:14136552-14136574 GCAGGGTGGTGGCAGGAGGAGGG + Intergenic
987084859 5:14458871-14458893 GGTGTGGTCTGGAAGGAGGTAGG - Intronic
988496759 5:31751859-31751881 GCTGGGCTGGGGGAGGAGGTGGG + Intronic
988615875 5:32774384-32774406 GCAGATGTGGGGAAGGAGGAGGG + Intronic
989128979 5:38085338-38085360 ACTGGTGTTTGGAAAGAGGATGG - Intergenic
989159387 5:38375744-38375766 GCTGAAGTGAGAAAGGAGGATGG + Intronic
989330434 5:40251945-40251967 GCTGGAGGGTGGGAGGAGGATGG - Intergenic
989661084 5:43798299-43798321 GCTGTGGGGTGGGAGGAGGGGGG - Intergenic
990008633 5:50969607-50969629 GCCGGGGAGCGGAAGGGGGAGGG + Intergenic
991354581 5:65754672-65754694 TATGGGGTGTGGGAGGAAGAGGG - Intronic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
992410239 5:76498460-76498482 CCTGAGGTTTGGAATGAGGAGGG - Intronic
993019766 5:82577537-82577559 TCTGGGGAGTGGGAAGAGGAGGG + Intergenic
993223629 5:85136590-85136612 GTTGTGGGGTGGGAGGAGGAGGG + Intergenic
993525204 5:88956614-88956636 GCTGGGGAGTGGCATGAGTAGGG + Intergenic
993628900 5:90259831-90259853 ATTGGGGAGTGGGAGGAGGAAGG + Intergenic
993779254 5:92045350-92045372 GCTAGAGAGAGGAAGGAGGAAGG - Intergenic
994338029 5:98591848-98591870 GTTGTGGGGTGGAGGGAGGAGGG + Intergenic
994576861 5:101589309-101589331 GTTGGGGTGGGGAGGGGGGAGGG + Intergenic
994621386 5:102166947-102166969 GCTGTGGGGTGGAGGGAGGGGGG + Intergenic
995387763 5:111607144-111607166 GCTGGGGAAGAGAAGGAGGAGGG - Intergenic
995612896 5:113929390-113929412 GTTGGGGGGTGGAGGGAGGGGGG - Intergenic
995624645 5:114063140-114063162 GCTAGAGTGTGGAATGAGGGAGG - Intergenic
995626073 5:114077599-114077621 ACTGAAGTGTGAAAGGAGGAAGG - Intergenic
996118410 5:119644321-119644343 CCTGGGCTGAGGATGGAGGAAGG - Intergenic
996147295 5:119991873-119991895 GCTGGAGTGTGGTGGGGGGAGGG - Intergenic
996215279 5:120858427-120858449 GTTGGGAGGTGGAAGGAGGGAGG + Intergenic
996283698 5:121763814-121763836 GCAGGGAAGTGGAAGGAGGAAGG + Intergenic
996560458 5:124822832-124822854 GCTGGGGTGGGGTAAAAGGATGG + Intergenic
997197413 5:131989203-131989225 GGTGGGGTGTGGATGGAGCATGG + Intronic
997561465 5:134849288-134849310 GCTCGGAAGTGGGAGGAGGAAGG + Intronic
997747409 5:136311217-136311239 AGTGGGGTCAGGAAGGAGGAGGG + Intronic
998184583 5:139968561-139968583 GCAGGGGACTGGAAGGAGGAAGG + Intronic
998360526 5:141582277-141582299 GATGGGGTTTGGAATGAGAATGG + Intronic
998366677 5:141636914-141636936 GCCTGGGTGTGGATGGAGGCGGG - Intergenic
998398462 5:141834921-141834943 AGTGGGGTGTGGAAGGAGCCAGG + Intergenic
998453135 5:142250005-142250027 CCTGGGGTGAGGTGGGAGGAAGG + Intergenic
998469710 5:142374327-142374349 GATGTGGTGGGGAAGAAGGAAGG - Intergenic
999295273 5:150455672-150455694 GCTGGGGTAGGGAAGGCAGAGGG + Intergenic
999424661 5:151476753-151476775 GCTGGTACGTGGAGGGAGGATGG + Exonic
999858661 5:155621786-155621808 GGTGGGGTGTGGTGGCAGGAAGG - Intergenic
999938303 5:156512776-156512798 ACATGGGTGTGGAAGTAGGAAGG - Intronic
1000192575 5:158925545-158925567 GGTGGCCAGTGGAAGGAGGAAGG - Intronic
1000533709 5:162455199-162455221 GAAGTGGTTTGGAAGGAGGAGGG + Intergenic
1000990150 5:167903525-167903547 GCTGGGGTGGGGGTGGAGGGTGG + Intronic
1001195873 5:169673119-169673141 GTTGGGGTGGGGCAGGTGGAGGG + Intronic
1001274104 5:170337715-170337737 GCTGTGGTGTAGAAGCAGAATGG - Intergenic
1001412918 5:171523588-171523610 TGTGGGGAGTGGAAGAAGGAGGG + Intergenic
1001588155 5:172847209-172847231 GGTGGGGAGAGAAAGGAGGATGG + Intronic
1001936030 5:175706686-175706708 GGTGGGGTGTTCAGGGAGGAAGG + Intergenic
1002000910 5:176195849-176195871 CCTGGGGTGAGGTAGGAGGTGGG + Intergenic
1002131806 5:177086769-177086791 GAGGGGGTGTGGCAGGAGGTGGG + Intergenic
1002188616 5:177467665-177467687 GCTGGGGTGGGGATGGCGGGAGG - Intronic
1002253424 5:177943123-177943145 CCTGGGGTGAGGTAGGAGGTGGG - Intergenic
1002329793 5:178433540-178433562 TCTGGGGTGGGGAAAGAGGCTGG - Intronic
1002633397 5:180595496-180595518 GCTGGGGTGTGGACGGACCTGGG + Intergenic
1002784567 6:391816-391838 GCTGGAGTCGGGCAGGAGGAGGG + Intronic
1002859376 6:1066538-1066560 GCTGGGGAGTGGAGGGACGCAGG + Intergenic
1002874960 6:1202555-1202577 GCTGGGGTGAGGAGGGAGAGCGG - Intergenic
1003042688 6:2702486-2702508 GGTGGGGTGGGGAAGGAAGGCGG + Intronic
1003064134 6:2888659-2888681 GCTGGGGGCTGGAGGAAGGAAGG + Exonic
1003129659 6:3385074-3385096 GCTGGGGAGAGGAGGGAGAATGG + Intronic
1003241405 6:4348792-4348814 GCTGTGGTGGGGAAGGCGGCTGG - Intergenic
1003482592 6:6546794-6546816 GCTGGGGTGGTGAGGGCGGATGG + Intergenic
1003746308 6:9006323-9006345 CCTGGGCTGTGGAAGAGGGAAGG - Intergenic
1004002805 6:11610891-11610913 GGTGAGGTGAGGAAGGAGGAGGG + Intergenic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1004866301 6:19856588-19856610 GCAGGAGTGGGGAAGGACGAAGG + Intergenic
1005210884 6:23460878-23460900 GGTAGGGTGTGGAATGGGGAAGG - Intergenic
1005713505 6:28524933-28524955 GGTGGAGGGTGGAAGGAGGGAGG + Intronic
1006104961 6:31710884-31710906 GCTGGTGGGGGCAAGGAGGATGG + Intronic
1006149997 6:31981998-31982020 GCTGGGCTGGGGGAGGAGCAAGG + Intronic
1006150471 6:31984197-31984219 GCTGGGGAGGGGAAGGGGCAAGG + Intronic
1006156298 6:32014736-32014758 GCTGGGCTGGGGGAGGAGCAAGG + Intergenic
1006156772 6:32016935-32016957 GCTGGGGAGGGGAAGGGGCAAGG + Intronic
1006269122 6:32950485-32950507 TCTGGGGAGTGAAGGGAGGAGGG - Intronic
1006277866 6:33020673-33020695 GATAGGGTCAGGAAGGAGGATGG - Intergenic
1006408863 6:33860473-33860495 GCTGAGCTGTGAGAGGAGGAAGG + Intergenic
1006642990 6:35497937-35497959 GCTGGGGCGGGCTAGGAGGAGGG - Exonic
1006726173 6:36200654-36200676 GCTGGGCTGTGGGAGGTGGAAGG - Exonic
1006852034 6:37105461-37105483 GATGGGGAGTAGGAGGAGGATGG + Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1006946148 6:37785611-37785633 GCTGCTGTGTGGGAGGAAGATGG - Intergenic
1007209185 6:40178077-40178099 ACTGGGTTGTGGGGGGAGGAAGG - Intergenic
1007300491 6:40864373-40864395 GCTGGTGTCTGGAACGAGGTTGG + Intergenic
1007337866 6:41167646-41167668 GCAGGGGTTTGGATGTAGGAAGG - Intergenic
1007372080 6:41432543-41432565 GCTGGGGTGGGGCAGGAGGCTGG - Intergenic
1007377475 6:41466667-41466689 GAAGGGGGGAGGAAGGAGGAAGG + Intergenic
1007380261 6:41485720-41485742 GTTGGGGTGGGGAAGGGGGCAGG - Intergenic
1007383184 6:41503723-41503745 GATGGGGTGTGGAATGAAGCTGG + Intergenic
1007404085 6:41623631-41623653 GGTGGGGAATGGAAGGTGGAAGG - Intergenic
1007705956 6:43791596-43791618 GCTGGAGGATGGAAGGAAGAAGG - Intergenic
1007830800 6:44636920-44636942 GCTGGGGTGAGCCAGGAGGAAGG + Intergenic
1008058091 6:46966300-46966322 GCTGGGGGATGGAAGGAGGAGGG - Intergenic
1008723473 6:54387533-54387555 GATGGGGAGTGGAGGGTGGATGG + Intronic
1008823714 6:55665563-55665585 TGTGGGGTGGGGAAGGAGGCAGG - Intergenic
1009303130 6:62052599-62052621 GGTGGGGTGGGGGTGGAGGAGGG + Intronic
1009572806 6:65410540-65410562 ACTGGGGAGGGGAAGGAAGAGGG - Intronic
1009714214 6:67367407-67367429 GCAGGGGTGGGGACTGAGGATGG - Intergenic
1010429223 6:75759460-75759482 GCTGCGGTTTTGAAGCAGGAGGG + Intronic
1010443378 6:75924962-75924984 ACTGGGGAGGGGAGGGAGGAGGG + Intronic
1010477310 6:76303882-76303904 ACTTGAGTGTGGAGGGAGGAGGG - Intergenic
1010608964 6:77928983-77929005 TGTGGGGTGTGGGAGGGGGAGGG + Intergenic
1010760213 6:79714107-79714129 CCTGGGTTCTGGAAGGAGGTGGG + Intergenic
1010999727 6:82574249-82574271 GCAGGGGTGAGGAAGAAGAAGGG + Intergenic
1011057607 6:83222665-83222687 GCTGAGGCTTGGGAGGAGGAGGG + Intronic
1011632351 6:89339573-89339595 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1012056513 6:94419080-94419102 GCTGGGAAGTGGAGGGCGGATGG - Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012627866 6:101426474-101426496 GCTGGGAAGTGTAGGGAGGAGGG - Intronic
1012849923 6:104434344-104434366 TCTGGGGATGGGAAGGAGGAAGG + Intergenic
1012935766 6:105365618-105365640 GCTGGGTTGGGAAAGGAGGAAGG + Intronic
1013096746 6:106952276-106952298 GGCGGGGTGTGCAATGAGGATGG + Intergenic
1013596827 6:111668098-111668120 GCTGGCGCTGGGAAGGAGGAGGG + Intronic
1013837583 6:114350684-114350706 GCTGGTGTGTGGGAGCAAGAAGG + Intergenic
1014090832 6:117402005-117402027 TCTGGGGTGTGGGAGGAAGCAGG - Intronic
1014898364 6:126931731-126931753 GCCGGGGTGTGGAAATTGGATGG + Intergenic
1015391165 6:132683736-132683758 GCTGGGGTGTGGGAGGACAATGG - Intronic
1015602507 6:134924132-134924154 GCTGGGCTGAGGCAGAAGGAGGG + Intronic
1015770909 6:136767389-136767411 GGAGGGGTGAGGAAGGAGGAAGG + Intronic
1016036474 6:139388642-139388664 GCTGGGGTGGGGCTGGGGGAGGG - Intergenic
1016338550 6:143035215-143035237 GCTGGAGTTTGGCAGGGGGAGGG - Intergenic
1016865469 6:148761636-148761658 GCAGGGCTGAGGAAGGAGGGTGG + Intronic
1017225678 6:152018581-152018603 GCTGGGGTGTTGGGGGTGGAAGG + Intronic
1017549758 6:155493393-155493415 GGTGGGGTGTGGATGGGGGGAGG + Intergenic
1017663447 6:156695998-156696020 AATGGGGTGAGGCAGGAGGAGGG - Intergenic
1017737932 6:157380999-157381021 CCTGGGGTGTGGAAGGCGCGGGG - Intergenic
1017791607 6:157804833-157804855 GCTGGAGCGTGGAGGGAGGGAGG + Intronic
1018040373 6:159916327-159916349 GCCGGGGGCTGGAGGGAGGAGGG + Exonic
1018186031 6:161265697-161265719 GGTGGGGAGGGGAACGAGGAGGG + Intronic
1018301435 6:162406849-162406871 ACTGGGGTGGGGAGGGAGGCAGG - Intronic
1018356548 6:163023220-163023242 ACTGGAGGGTGGAAGGAGGGGGG - Intronic
1018434957 6:163751422-163751444 GCTGCGGGGAGGGAGGAGGAGGG - Intergenic
1018625338 6:165772391-165772413 AATGGGGCTTGGAAGGAGGAGGG - Intronic
1018719070 6:166558567-166558589 GCTGGGCTGGGGCAGGGGGAGGG + Intronic
1018726723 6:166618417-166618439 GCCTGGGTGTGGAAGGGGTATGG + Intronic
1018736448 6:166690107-166690129 GCTGAGGGGTGGAGGGAGGAGGG + Intronic
1018844679 6:167547393-167547415 GATGGGGTGAGGAGGGAGGAGGG - Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1019004963 6:168789304-168789326 GCTGTGCTGAGGATGGAGGAAGG + Intergenic
1019356987 7:585587-585609 CCTGGGGTGTGGAGAAAGGAGGG + Intronic
1019495241 7:1335322-1335344 GGTGTGGTGGGGAAAGAGGAAGG + Intergenic
1019562474 7:1665604-1665626 GCTGGGGGGTGGCCGGAGGGGGG - Intergenic
1019595088 7:1854712-1854734 GCTGGGGTGGAGAAGGATGTGGG - Intronic
1019700317 7:2471631-2471653 GCTGGGCTGTGGATGCAGGCGGG + Intergenic
1019869988 7:3751453-3751475 GGTGGGGGGAGGAGGGAGGAGGG + Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1021284005 7:18756854-18756876 GTTGGGGAGTGAAAGAAGGAAGG - Intronic
1022173179 7:27849017-27849039 GCTGGGGTGTGGGAGGGTAAGGG + Intronic
1022381824 7:29867545-29867567 GCTGGGGTGTGGAGGGGGCGGGG - Intronic
1022396238 7:29989863-29989885 GCCGGGGTGGGGGAGGCGGAGGG - Intronic
1022848749 7:34238040-34238062 GGTGGGGCGTTGGAGGAGGAGGG - Intergenic
1023013610 7:35944187-35944209 GCTGAGGTGGGGCAGGGGGAGGG + Intergenic
1023242248 7:38160935-38160957 GCAGGGCTGAGGGAGGAGGAGGG - Intergenic
1023797620 7:43806851-43806873 GCTGGTGGCTGCAAGGAGGATGG + Intronic
1023821895 7:43985310-43985332 CCTGAGGTGTGGAGGGTGGAGGG - Intergenic
1023980809 7:45068881-45068903 GCTGGGGGTTGGAGGTAGGAGGG - Intronic
1024077519 7:45829647-45829669 GCTGAGGTGGGGCAGGGGGAGGG - Intergenic
1024229520 7:47353724-47353746 GCTGGGCTGTGGTAGGAGGGAGG - Intronic
1024293881 7:47827500-47827522 GCTGGTGGGTGGAAGGAGAGAGG + Intronic
1024569190 7:50710036-50710058 GATGGGGTGTGCATGGTGGATGG - Intronic
1024636229 7:51292710-51292732 TCTGGAGTGTGGAGGGAGGAGGG - Intronic
1024767616 7:52679105-52679127 GCTGGGAGATGGAAGGTGGAAGG - Intergenic
1025126894 7:56351765-56351787 GCTGAGGTGGGGCAGGGGGAGGG + Intergenic
1025239321 7:57257961-57257983 TCTGGTTTCTGGAAGGAGGATGG - Intergenic
1025288102 7:57685332-57685354 GCTGGGGTGGGGACAGAGTAGGG - Intergenic
1025852394 7:65254747-65254769 GCTGGAGTGTGGTGGCAGGATGG + Intergenic
1026328001 7:69327600-69327622 GCTGGAGGATGGAAGGAAGAAGG + Intergenic
1026449619 7:70516270-70516292 GCGGGTGTGTGGAAGGAGGAGGG - Intronic
1026618510 7:71929269-71929291 GGTGGGGAGTGGGAGGAGGGAGG - Intronic
1026853052 7:73736831-73736853 CCTTGGGTGTGGAAGGGGGGTGG - Intronic
1027218636 7:76200372-76200394 GCTGAGGAAGGGAAGGAGGATGG + Intergenic
1027345798 7:77258227-77258249 GCCAGGGGGTGGAGGGAGGAGGG - Intronic
1028320409 7:89452437-89452459 GATGGAGTGTGGAGGGGGGAGGG + Intergenic
1028431194 7:90749179-90749201 GCCCGGGTGTGGAATGAAGAGGG - Intronic
1029115244 7:98233345-98233367 TGTGGGGTGTGGGAGGAGGCCGG - Intronic
1029148425 7:98463299-98463321 GCTGGGGTGGGGATGGGGAACGG + Intergenic
1029622599 7:101699305-101699327 GCTGCGCTGAGGCAGGAGGAGGG - Intergenic
1029709815 7:102293406-102293428 GCTGGGGGATGGAGCGAGGAGGG - Intronic
1029750160 7:102538732-102538754 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1029768111 7:102637840-102637862 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1030033519 7:105389106-105389128 GCTGGGGTGGGGGAGGCCGAGGG - Intronic
1030033888 7:105392187-105392209 GTTGGGGGGTGGGAGAAGGAGGG + Intronic
1030311829 7:108076600-108076622 GCAGGGATGTGGAAGCAGGCTGG + Intronic
1030498389 7:110328690-110328712 TCAGGGGCTTGGAAGGAGGAAGG + Intergenic
1030513778 7:110517127-110517149 GCTGGAGGGTGGAAGGTGGGAGG + Intergenic
1030651028 7:112116162-112116184 GCTGGGGAGAGGAGGGTGGAGGG - Intronic
1031334470 7:120510838-120510860 GGTTGGGGGTAGAAGGAGGAGGG - Intronic
1031427295 7:121621199-121621221 GTTGGGGGGTGGCGGGAGGAAGG + Intergenic
1031701181 7:124929105-124929127 GTTGGGGGGTGACAGGAGGATGG + Intronic
1031705802 7:124979613-124979635 GTTGTGGGGTGGGAGGAGGAGGG - Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032117334 7:129127811-129127833 GCAGGGGTGAGGCAGGAGGGTGG - Intergenic
1032806770 7:135362967-135362989 GGTGGGGAGTGGAAGCTGGAAGG + Exonic
1032854756 7:135825121-135825143 GCTGAGGTGAGACAGGAGGAGGG - Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033443694 7:141402397-141402419 GCAGGGGGAGGGAAGGAGGAAGG - Intronic
1033563987 7:142560981-142561003 GCTGGGAGGTAGAAGGAGAAGGG - Intergenic
1033943205 7:146681425-146681447 GGTGGGGGGTGGAGGGTGGAGGG + Intronic
1034085871 7:148322026-148322048 GTTGGGGTGGGGGAGGGGGACGG - Intronic
1034202464 7:149291020-149291042 GGTGGGGTGTGGCAGGATGCAGG + Intronic
1034306586 7:150048807-150048829 GCTGGGCTGTGGAGGGAGGGCGG - Intergenic
1034426416 7:151016562-151016584 TCTGGGGTGTGGCGGGAGGAGGG - Intronic
1034800261 7:154051836-154051858 GCTGGGCTGTGGAGGGAGGGCGG + Intronic
1034889753 7:154829451-154829473 GGTGGGGAGGGGAGGGAGGAGGG + Intronic
1034896181 7:154877875-154877897 GGTTCAGTGTGGAAGGAGGATGG + Intronic
1034941406 7:155232663-155232685 GCTGGGAAGAGGAAGGAGGCAGG + Intergenic
1035205481 7:157291580-157291602 GCAGGGGTGTGGCAGGAGGGCGG + Intergenic
1035239974 7:157523195-157523217 GCTGGGGAGGGGAAGGACGTGGG + Intergenic
1035331374 7:158099121-158099143 GCCGGGTTGTGGGGGGAGGAAGG - Intronic
1035331414 7:158099214-158099236 GCCGGGATGTGGGGGGAGGAAGG - Intronic
1035331427 7:158099244-158099266 GCCGGGATGTGGTGGGAGGAAGG - Intronic
1035331438 7:158099274-158099296 GCCGGGATGTGGGGGGAGGAAGG - Intronic
1035331451 7:158099304-158099326 GCCGGGATGTGGGGGGAGGAAGG - Intronic
1035331489 7:158099397-158099419 GCCGGGATGTGGGGGGAGGAAGG - Intronic
1035331527 7:158099490-158099512 GCCGGGATGTGGGGGGAGGAAGG - Intronic
1035331629 7:158099739-158099761 GCCGGGATGTGGTGGGAGGAAGG - Intronic
1035651955 8:1273245-1273267 ACTTGGGTGTGGAAAGAGGTGGG + Intergenic
1035675257 8:1451528-1451550 GCTGAGGTGGGGAAGGATTAAGG - Intergenic
1035911197 8:3567887-3567909 GATGATGTGTGGAAGGAAGAAGG - Intronic
1036040162 8:5069174-5069196 TCTGGGGGGTAGAAGCAGGAGGG - Intergenic
1036936683 8:13009243-13009265 GCTGGGGTGTCGAAGCGGGTGGG + Intronic
1037147004 8:15584701-15584723 GTGGGGGTGGTGAAGGAGGAGGG + Intronic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037887357 8:22602008-22602030 CCTGGGGTGTGTAACGGGGACGG - Exonic
1038023655 8:23570916-23570938 GATGTGTTGGGGAAGGAGGAGGG + Intronic
1038223015 8:25628534-25628556 TCTAGGGGCTGGAAGGAGGATGG + Intergenic
1038287713 8:26220462-26220484 ACTGGGTTATGGAAGGAGAAGGG - Intergenic
1039312096 8:36327870-36327892 GCAGGGATTTGGAAGGAGAATGG - Intergenic
1039423896 8:37469456-37469478 GCTGTAGGGTGGAAGGCGGAAGG - Intergenic
1039547511 8:38420685-38420707 GGAGGCCTGTGGAAGGAGGAGGG - Intronic
1039828675 8:41195525-41195547 ACTGGGGCGTGGAGGCAGGAAGG + Intergenic
1039952608 8:42183593-42183615 GATGGGCTTGGGAAGGAGGAGGG + Intronic
1040884791 8:52249949-52249971 GTCGGGGGGAGGAAGGAGGAAGG - Intronic
1041450722 8:58004036-58004058 GATGGGGTGGGGGAGGGGGATGG + Intronic
1041560235 8:59209248-59209270 ACTGGAGGGTGGAAGGAGGGAGG - Intergenic
1041908269 8:63057668-63057690 GTATGGGTGTGGGAGGAGGATGG + Intronic
1042163692 8:65923909-65923931 GCTGGGCAGAGGAAGGAGGCTGG + Intergenic
1042311045 8:67379788-67379810 GATGGGGAGGGGAAGGAGGAAGG - Intergenic
1042395580 8:68287951-68287973 GTTGGGGTGAGGGAGGAGGATGG + Intergenic
1042507285 8:69574060-69574082 GGTGGTGTGTGGATTGAGGAGGG - Intronic
1042770417 8:72374719-72374741 GTTGGGGTGTGGAAGCTGGGTGG + Intergenic
1042887132 8:73564503-73564525 GGTGGAGGGTGGAAGGTGGAAGG + Intronic
1044053385 8:87538389-87538411 GCTGGGGGGTGGGGGGAGGGGGG - Intronic
1044201355 8:89442092-89442114 GCTAGAGTGTGGAGGGAGGGAGG + Intergenic
1044321294 8:90804359-90804381 GCGGGGGAGTGAAAGGAGTAGGG + Intronic
1044995092 8:97830915-97830937 GCTGGTGTCTGGAATGAGGTTGG + Intronic
1045045535 8:98272401-98272423 ACTGAGGTGTGGAAAAAGGAAGG + Intronic
1045300132 8:100903670-100903692 CCTGGGGAGTGGAATGAGGAAGG - Intergenic
1045322525 8:101092569-101092591 GCAGCTGTGAGGAAGGAGGATGG - Intergenic
1045489604 8:102658065-102658087 GCTGGAGTGTGGGTGGAGGTTGG - Intergenic
1045714586 8:105026469-105026491 GCCTGGGCGTGGAAGCAGGAGGG - Intronic
1046766059 8:118071530-118071552 GCAGGGGTGGGGGAGGAGTAAGG + Intronic
1046800630 8:118422883-118422905 ACTGTGGTGTGGGAGGAGCAAGG + Intronic
1046832973 8:118767028-118767050 TCTGGGGTTTTGAGGGAGGAAGG - Intergenic
1046875571 8:119251221-119251243 GCCAGGGGCTGGAAGGAGGAGGG + Intergenic
1047234315 8:123026038-123026060 GAGGGGGTGTGGAACGGGGAGGG - Intronic
1047314781 8:123722862-123722884 GATTGGGTGTGAAATGAGGAGGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047824577 8:128559547-128559569 GCTGGGGGGTGAGAGGAGAAGGG + Intergenic
1048007485 8:130431218-130431240 GCCAGGGTCTGGAAGCAGGAAGG - Intronic
1048096623 8:131302242-131302264 GCTAGGGCTTGAAAGGAGGAAGG - Intergenic
1048367362 8:133750221-133750243 CCTGGGGTGGGGGAGAAGGAGGG - Intergenic
1049386058 8:142343744-142343766 GATGGGGAGTGGGGGGAGGAGGG + Intronic
1049464910 8:142746701-142746723 GATGGGGGATGGATGGAGGATGG + Intergenic
1049508099 8:143014524-143014546 GCTCTGGTGTGGGAGGAGGAGGG + Intergenic
1049651275 8:143771118-143771140 GCTGGGGCCTGGATGCAGGAGGG + Intergenic
1049785404 8:144448390-144448412 TCTGGGGTGGGGAAGGTGGGAGG - Intergenic
1050011513 9:1189952-1189974 GGTGGGGTGGGGGAGGAGGGAGG - Intergenic
1050184826 9:2962165-2962187 GGTGGCGTGGAGAAGGAGGACGG - Intergenic
1050189531 9:3010279-3010301 ACGGGAGTGTGGAAGAAGGAAGG - Intergenic
1050526204 9:6548984-6549006 GCTGAGATGTGGATGGAGGTCGG - Intronic
1050597315 9:7216663-7216685 GCTGGAGCTTGGCAGGAGGAGGG + Intergenic
1050719951 9:8576993-8577015 GCTGCATTGTGGAAGGAGAATGG - Intronic
1051179548 9:14395888-14395910 GCTGGGGTGTGGGTGGGGGTGGG + Intronic
1051369642 9:16347385-16347407 GCTGGGTTGTGGGATGAGAAGGG - Intergenic
1051605787 9:18916829-18916851 GGTGGAGAGTGGAAGGAGAATGG - Intergenic
1051614846 9:18997372-18997394 GCTGGAGTGTGGTAAGAGGAGGG + Intronic
1052049592 9:23830226-23830248 GCTAGGGGGTGGAGGGAGCAGGG - Intergenic
1052095776 9:24381975-24381997 GGTGGGGTGGGGAAGGAAGCTGG - Intergenic
1052617272 9:30857020-30857042 GTTGTGGGGTGGAAGGAGGGGGG - Intergenic
1052879732 9:33594105-33594127 GGTTGGGGGTGGAAGGAGAAAGG + Intergenic
1053004762 9:34597135-34597157 ACTGGGGTGGGGAAGCATGAAGG - Intergenic
1053142674 9:35690940-35690962 GCTGCGGCGGGGAAGGCGGAGGG + Exonic
1053147869 9:35724153-35724175 GCTGGGGTGGGGCAGGAATAGGG - Intronic
1053163837 9:35830862-35830884 GTTGGAATGTGGGAGGAGGAGGG + Intronic
1053218266 9:36290656-36290678 GCTTGGGAGGGGAAGGACGAGGG - Intronic
1053267623 9:36726505-36726527 GCGGGGGTGGGGCAGGAGGGTGG + Intergenic
1053585792 9:39457261-39457283 GCGGAGATGTGGAAGAAGGAAGG - Intergenic
1053787921 9:41665443-41665465 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1053859497 9:42372614-42372636 AATGAGGTGTGAAAGGAGGATGG - Intergenic
1054176197 9:61876785-61876807 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1054251690 9:62723580-62723602 AATGAGGTGTGAAAGGAGGATGG + Intergenic
1054490135 9:65767687-65767709 GGTGGGGTGTGGGGGGGGGAGGG + Intergenic
1054565802 9:66758097-66758119 AATGAGGTGTGAAAGGAGGATGG + Intergenic
1054580515 9:66907961-66907983 GCGGAGATGTGGAAGAAGGAAGG + Intronic
1054661342 9:67704023-67704045 GCTGGGCTGTGGAGGAAAGATGG + Intergenic
1054700524 9:68408274-68408296 GCTGGGGTGTGGCTGCAGGTAGG + Intronic
1055187497 9:73474272-73474294 GCTGGGGAGGGGGAGGGGGAGGG - Intergenic
1055294791 9:74823193-74823215 GCAGGGGTGTGGCCAGAGGAAGG - Intronic
1055570758 9:77614721-77614743 GCTGAAGTGGGGAAGAAGGAAGG - Intronic
1055581441 9:77711054-77711076 GATGGGGAGGGGAAGGAGGAGGG - Intergenic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1055827669 9:80346114-80346136 GTTGTGGGGTGGAGGGAGGAGGG + Intergenic
1056089275 9:83188697-83188719 GCTGGGCTGCGGTAGGTGGAAGG - Intergenic
1056679806 9:88706964-88706986 GCTGCGCTGTGGAGGCAGGATGG + Intergenic
1056910804 9:90698421-90698443 GCTGGAGGGTGGATGGTGGAGGG + Intergenic
1057184043 9:93046425-93046447 GGGGGGGTGTGGCAGGAGGGTGG + Intergenic
1057191827 9:93092702-93092724 GCCCGGGTGAGGGAGGAGGATGG + Intergenic
1057231586 9:93324680-93324702 GAGGGTGTGTGGATGGAGGAGGG + Intronic
1057236503 9:93365937-93365959 GAGGGTGTGTGGATGGAGGAGGG - Intergenic
1057369447 9:94456956-94456978 GGTGGGGGGTGGGGGGAGGAAGG - Intronic
1057602824 9:96473370-96473392 ACTGGGTTTTGGAAAGAGGAGGG - Intronic
1057806495 9:98223359-98223381 CCTGGGGTGTGGCAGGAAGTTGG + Intronic
1058074610 9:100638008-100638030 GCTGGAGTTTGGCAGGGGGAGGG - Intergenic
1058296241 9:103311693-103311715 GCTGTGGGGTGGAGGGAGGGGGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058389058 9:104473511-104473533 GCTGGGGAATGGAAGTAGAAGGG - Intergenic
1059312225 9:113396504-113396526 GCAAAGGTGGGGAAGGAGGATGG + Intronic
1059314220 9:113410445-113410467 GCGGGGCTGTGGGGGGAGGAGGG - Intronic
1059326629 9:113507648-113507670 GCTGGTGTGGGGAAGGTGAAGGG + Intronic
1060153957 9:121306082-121306104 TCTGCGGAGTGGGAGGAGGAGGG - Intronic
1060216963 9:121744219-121744241 ACTAGGGAGTGGAAGCAGGAAGG - Intronic
1060276457 9:122186593-122186615 ACTGGGGTGGGGAGAGAGGATGG - Intronic
1060281307 9:122217338-122217360 ATTGGGTGGTGGAAGGAGGAAGG - Intronic
1060482217 9:124023177-124023199 ACTGGGTTGGGGAAGGACGAAGG - Intronic
1060887617 9:127166822-127166844 GGTGGGGTGTGTAAGAGGGATGG + Intronic
1060945402 9:127567343-127567365 CCTGGACTGTGGGAGGAGGAAGG - Intronic
1061130891 9:128707080-128707102 GCAGGGGTGTGAAGGGAGGGTGG + Intronic
1061244844 9:129396243-129396265 GATGAAGTGTGGATGGAGGACGG + Intergenic
1061411992 9:130426898-130426920 GCTGGGTTCTGGAGGCAGGAAGG - Intronic
1061670580 9:132185968-132185990 CCTGGTGTGGGGAAGGAGGAGGG + Intronic
1061869254 9:133511440-133511462 GCTGTGGTGGGGAGGGAGGTGGG + Intergenic
1061924012 9:133797206-133797228 CCTGGGGTGAGGATGGATGAGGG + Intronic
1061924053 9:133797339-133797361 CCTGGGGTGAGGATGGATGAGGG + Intronic
1061972871 9:134054248-134054270 GCTGGGGTGTGGAGGTCGGCAGG - Intronic
1062005883 9:134238171-134238193 GATGGGGTTTGGAAGGAGATGGG + Intergenic
1062035949 9:134382603-134382625 GCTGGGGTGTGGATTCACGAGGG + Intronic
1062143719 9:134976696-134976718 GATGGGGAGGGGAAGGGGGAGGG - Intergenic
1062266165 9:135687474-135687496 GATGGCGTGGGGAAGCAGGAAGG + Intergenic
1062267654 9:135694738-135694760 GCTGGGGTGTGGGAGGGGGAGGG - Intronic
1062464543 9:136675335-136675357 GCTGGGGACTGGCAGCAGGAAGG + Intronic
1062464573 9:136675417-136675439 GCTGGGGACTGGCAGCAGGAAGG + Intronic
1062466896 9:136685603-136685625 CCTGGGGTGTGGACAGGGGACGG - Intronic
1203612451 Un_KI270749v1:21679-21701 GCTGGGGTGGGGACAGAGTAGGG + Intergenic
1185449498 X:275029-275051 CCAGGGCTGTGGAAGGAGGCGGG + Intergenic
1186294610 X:8134995-8135017 GGTGGAGTGTTGGAGGAGGAAGG + Intergenic
1187496561 X:19800988-19801010 GCTCTGCTGGGGAAGGAGGAAGG - Intronic
1187913438 X:24131727-24131749 GGTGGAGGCTGGAAGGAGGAGGG - Intergenic
1188010183 X:25046513-25046535 GGTGGGGTTTGGACAGAGGAAGG - Intergenic
1188013001 X:25077233-25077255 CCTGGGGACAGGAAGGAGGATGG - Intergenic
1188515053 X:30976263-30976285 GCTAGAGTGTGGAAAGAAGAAGG + Intergenic
1189422440 X:40868172-40868194 GATGGGGTATGGAAAGAGGTTGG - Intergenic
1189436019 X:40993409-40993431 GGTGGGGTGGGGCAGGAGGAGGG - Intergenic
1189498149 X:41528716-41528738 GCTGGAGTGGGAAAGGGGGATGG + Intronic
1189609698 X:42719078-42719100 GGTGGGGTGGGGATGGGGGATGG - Intergenic
1191219282 X:57969669-57969691 GGTGGAGGGTGGAAGTAGGAAGG - Intergenic
1191712240 X:64162427-64162449 GCTGGGGAGAGTAGGGAGGAGGG - Intergenic
1191750765 X:64540069-64540091 GTTGTGGGGTGGAAGGAGGGGGG + Intergenic
1191900447 X:66034771-66034793 GTGGGGGTGGGGAAGGAGGTGGG + Intronic
1192434271 X:71133225-71133247 GCTGGGGAGAAGAAGGAAGAGGG + Intronic
1192945187 X:75958713-75958735 ACTGGGGGGTGGAGGGTGGAAGG - Intergenic
1193333318 X:80259661-80259683 GCTGGGGTGGTGGGGGAGGAAGG + Intergenic
1193448276 X:81633728-81633750 TCAGGGGTGGGGAAGGGGGAGGG - Intergenic
1193973364 X:88085892-88085914 ACTTGAGTGTGGAAGGTGGAAGG - Intergenic
1195082369 X:101383899-101383921 TCTGGGGAGGGGAAGGAGGAGGG - Intronic
1195090509 X:101454136-101454158 GATGGGGTGGGGAAGGAGCAGGG + Intronic
1195096575 X:101506851-101506873 TCTGGGGTGGGGAAGGATGAAGG - Intronic
1195148349 X:102041186-102041208 GTTGGGGTGTGGGGGGAGGGGGG + Intergenic
1195569167 X:106380066-106380088 AATGGGGACTGGAAGGAGGATGG - Intergenic
1195571405 X:106401932-106401954 GCTGAGGACTGGAAAGAGGACGG + Intergenic
1196007164 X:110849294-110849316 GCTGGGGTGGGGAAGTTGGTGGG + Intergenic
1196685879 X:118509884-118509906 GCTGGTTTGAGGAGGGAGGAAGG - Intronic
1196889279 X:120276629-120276651 GGTGGGGGGTGAAAGGAGGAAGG - Intronic
1196976571 X:121164182-121164204 ACTGGAGAGTGGAGGGAGGAGGG - Intergenic
1197573237 X:128176143-128176165 GCTTGGGGGTGGAAGGTGGGAGG + Intergenic
1197783244 X:130177090-130177112 GATGGGGTGCTGGAGGAGGATGG - Intronic
1197970144 X:132106874-132106896 GGTGGAGTGTGGCAGGAGGGAGG + Intronic
1198244852 X:134820482-134820504 GCTAGGGGCTGGGAGGAGGAGGG + Intronic
1199977055 X:152900327-152900349 GCTTGAGTAGGGAAGGAGGAAGG - Intergenic
1200133130 X:153862256-153862278 GCTGGGGAGTGGCTGGGGGAGGG + Exonic
1200138287 X:153885457-153885479 GCTGGGATTTGGAAAGAAGAAGG + Intronic
1200160579 X:154006139-154006161 ACTGGGATCTGGAAGGCGGAGGG + Intergenic
1200376910 X:155791638-155791660 GCTGGGGGTTGGGAGGAGGCGGG + Intergenic
1200684683 Y:6247692-6247714 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200903130 Y:8453585-8453607 GTTGTGGGGTGGACGGAGGAGGG - Intergenic
1200990213 Y:9338957-9338979 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200992875 Y:9359272-9359294 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200995528 Y:9379550-9379572 GATGGGTAGTGGAAGGAAGATGG + Intronic
1200998194 Y:9399896-9399918 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201000703 Y:9468430-9468452 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201003369 Y:9488760-9488782 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201006025 Y:9509042-9509064 GATGGGTAGTGGAAGGAAGATGG + Intergenic
1201008683 Y:9529355-9529377 GATGGGTAGTGGAAGGAAGATGG + Intronic
1201011261 Y:9549524-9549546 GATGGGTGGTGGAAGGAAGATGG + Intergenic
1201624739 Y:16002306-16002328 GCAGGTGTGTGGCAGGAGGTAGG + Intergenic
1202116052 Y:21469577-21469599 GATGGGTGGTGGAAGGAAGATGG + Intergenic