ID: 992142835

View in Genome Browser
Species Human (GRCh38)
Location 5:73816737-73816759
Sequence TGGACATGGGTCATTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992142835_992142840 10 Left 992142835 5:73816737-73816759 CCTTTGGAAATGACCCATGTCCA 0: 1
1: 0
2: 2
3: 14
4: 154
Right 992142840 5:73816770-73816792 TGATGAAAGCAGTTAAAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992142835 Original CRISPR TGGACATGGGTCATTTCCAA AGG (reversed) Intronic