ID: 992142835

View in Genome Browser
Species Human (GRCh38)
Location 5:73816737-73816759
Sequence TGGACATGGGTCATTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992142835_992142840 10 Left 992142835 5:73816737-73816759 CCTTTGGAAATGACCCATGTCCA 0: 1
1: 0
2: 2
3: 14
4: 154
Right 992142840 5:73816770-73816792 TGATGAAAGCAGTTAAAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992142835 Original CRISPR TGGACATGGGTCATTTCCAA AGG (reversed) Intronic
902446583 1:16469581-16469603 AGGCCATGGGCCATTTTCAATGG + Intergenic
902456723 1:16538847-16538869 TGGAGATGGGGCTTTTCCAAGGG + Intergenic
903576174 1:24341068-24341090 TGCATCAGGGTCATTTCCAAAGG + Intronic
905858831 1:41332677-41332699 TGGACATGGGGCATTTAAAGAGG - Intergenic
909104904 1:71394950-71394972 TGAACATGGGTAATTTATAAAGG - Intergenic
912632993 1:111264500-111264522 TGCACATGGATCATTCTCAAGGG - Intergenic
913536035 1:119773501-119773523 TAAACAGGGCTCATTTCCAAAGG - Intergenic
913661969 1:121012490-121012512 TGGAGATGGGGCTTTTCCAAGGG + Intergenic
914013343 1:143795675-143795697 TGGAGATAGGGCTTTTCCAAGGG + Intergenic
914164480 1:145165510-145165532 TGGAGATAGGGCTTTTCCAAGGG - Intergenic
914651967 1:149704284-149704306 TGGAGATAGGGCTTTTCCAAGGG + Exonic
915250109 1:154581909-154581931 TTGAAATGGCTCCTTTCCAAAGG + Intergenic
916422383 1:164649056-164649078 TGGACCTGGATCATTTTCAGGGG + Intronic
918521130 1:185416046-185416068 TCAACATAGGGCATTTCCAATGG + Intergenic
919561751 1:199128731-199128753 TGGACTTGTGTCAATTCAAAAGG - Intergenic
920800422 1:209182562-209182584 TGGAACTGGGTAAGTTCCAAAGG + Intergenic
922459523 1:225804258-225804280 TGGACATTTGTCACATCCAATGG - Intergenic
922965692 1:229689139-229689161 TGGGCATGGATCAGTTCCACTGG + Intergenic
1063076882 10:2725822-2725844 TGGAAAATGATCATTTCCAAAGG + Intergenic
1070194909 10:74148414-74148436 GGGAGAGAGGTCATTTCCAAAGG + Intronic
1071023384 10:81083862-81083884 TGGACATGGCTCCTATCCTAGGG + Intergenic
1071069438 10:81674152-81674174 TGGGGATTGGTCATTTCCATTGG + Intergenic
1071171554 10:82870612-82870634 TGGATTTGGGTCATTTCAATAGG + Intronic
1071312753 10:84359067-84359089 TGGTCTTGAGTCATTTCCAGTGG - Intronic
1072924866 10:99608262-99608284 GATACCTGGGTCATTTCCAAGGG - Intergenic
1073807320 10:107111498-107111520 TGGACTTGGCTAATTTCAAATGG - Intronic
1074952835 10:118356566-118356588 TAGAGATGGATTATTTCCAAAGG - Intergenic
1077498053 11:2896272-2896294 TGGACATCCGTCCTTTGCAAGGG + Intronic
1083620029 11:64044665-64044687 TGAACTTGGGTCCTTTACAAAGG + Intronic
1087373507 11:97315336-97315358 TGGACATGAACAATTTCCAATGG - Intergenic
1087714716 11:101594770-101594792 TGGGCATGGATCAATTCCATTGG - Intronic
1087793174 11:102428734-102428756 TGGAGATGGATCATTTCCTGAGG - Intronic
1088046660 11:105460366-105460388 AGAACATGGGTCATTATCAAGGG + Intergenic
1089159855 11:116429011-116429033 TGGGCCTCAGTCATTTCCAAAGG - Intergenic
1090615026 11:128506757-128506779 TGGGCACGGGCCATTTCCAGAGG + Intronic
1095470237 12:42528992-42529014 GGGACAGGGGCCATTTTCAAGGG - Intronic
1096871021 12:54592203-54592225 AGGCTATTGGTCATTTCCAAAGG - Intergenic
1097670656 12:62533554-62533576 AGGGCATGGGACATGTCCAAAGG - Intronic
1098361738 12:69660939-69660961 TGGATATTTGTCATTTGCAAGGG - Intronic
1099020021 12:77391519-77391541 TGCACATTGGTCTTTCCCAAGGG + Intergenic
1100155838 12:91799294-91799316 GGGACATGGATCCTTTCCTATGG + Intergenic
1105580192 13:21688340-21688362 TGGAGATGGGTGGTTTTCAACGG + Intronic
1108286108 13:48909543-48909565 TGAGAATGGGTCATTTGCAAAGG - Intergenic
1108511720 13:51162340-51162362 TGGACATGGGTCTGTTCCGCAGG - Intergenic
1109142813 13:58736406-58736428 AGGACATGGTCCTTTTCCAAAGG - Intergenic
1112658350 13:101477053-101477075 TGCACATGGATCATTCTCAAGGG + Intronic
1113280917 13:108786474-108786496 TGGCCAAGGGTCATTTTGAAGGG - Intronic
1114730341 14:24986434-24986456 TGGACATGTGACTTTTCCCAGGG - Intronic
1124121255 15:26891191-26891213 TGGAGATGGTCCATTTGCAAAGG - Intronic
1125925857 15:43562562-43562584 TGGACTTGGGTCTTTTCTCATGG + Intronic
1125939001 15:43662113-43662135 TGGACTTGGGTCTTTTCTCATGG + Intronic
1126062145 15:44792978-44793000 TGGACATGGGTCATTTCTCACGG - Intergenic
1126733141 15:51705165-51705187 TATACATGGGTCACTTCCAGAGG - Intronic
1128236540 15:66071414-66071436 TTGACATGGGTCACAGCCAAGGG - Intronic
1129464342 15:75715593-75715615 TGGTCAGGGGTCAGTTCCAAAGG - Intergenic
1129720906 15:77877419-77877441 TGGTCAGGGGTCAGTTCCAAAGG + Intergenic
1132233369 15:100200933-100200955 TGCACATTGCTCCTTTCCAAGGG + Intronic
1135484884 16:22855489-22855511 TGGACAGGGGAAATTTCCCAAGG - Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137699722 16:50488885-50488907 AGGTCATGGGTCCTTCCCAAGGG + Intergenic
1140296514 16:73714351-73714373 TGGAGATGTGTCCTTTCCAAGGG - Intergenic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1151159578 17:72153666-72153688 GGAACAGGGGACATTTCCAATGG - Intergenic
1151555430 17:74844188-74844210 TGGCCATGGCCCATTTCCAGAGG - Intronic
1153047861 18:872839-872861 TGGACCTAGGTCATCTCCCAGGG + Intergenic
1153103146 18:1497358-1497380 TTGGCATGGGTCATCTCTAAGGG - Intergenic
1155457543 18:26034785-26034807 TGGAGATGGTTCATGACCAAAGG - Intronic
1158442461 18:57489093-57489115 TTTACATGGGACATTACCAAAGG + Exonic
1162177027 19:8838325-8838347 TTGACATCTGTCATTTCCACAGG - Intronic
1163309292 19:16503455-16503477 TGGTCATGGGGCATTGCCACAGG + Intronic
1164556843 19:29259819-29259841 TGGAAATCAGACATTTCCAAGGG - Intergenic
1164862965 19:31577749-31577771 TGGACATGGTTCAGTTCCCCAGG - Intergenic
1164965163 19:32476963-32476985 TGATCATGAGTCAGTTCCAAGGG - Intronic
1168430703 19:56277508-56277530 TGGACATTAGTGATTTCCAGGGG + Intronic
926229472 2:10991854-10991876 TGGACAGAGGTCATTCCCAAAGG - Intergenic
933695376 2:85213559-85213581 ATGACATGGGACACTTCCAAGGG - Intronic
933950892 2:87328532-87328554 TGTAAATGGGTTGTTTCCAATGG + Intergenic
935831484 2:107005396-107005418 TGTACAATGGTCATTTCCAGAGG - Intergenic
936416946 2:112324304-112324326 TGCACATGGGTGATGTCCAGGGG - Exonic
936754159 2:115684935-115684957 TGGAAATGAATCATTTGCAAAGG + Intronic
937485663 2:122312342-122312364 TGGAATTGGGTCATTTTAAAAGG + Intergenic
940672948 2:156693360-156693382 TGGACATGGGGAATTTCAAGTGG - Intergenic
942161382 2:173191875-173191897 TGGAGATGGGCCATTTCCTGAGG + Intronic
944917299 2:204374167-204374189 AGGACATGGGTCACTTCCTGGGG + Intergenic
945195882 2:207237433-207237455 TGGAAATGGGGGATTTCCTATGG - Intergenic
945683994 2:212946925-212946947 TGTCCTTGGGTCATTTACAATGG - Intergenic
946782613 2:223206290-223206312 TGCACATGGGTGATTGCCAGTGG - Intergenic
947081441 2:226401311-226401333 TGGAAATGTGTCCTGTCCAAGGG - Intergenic
1173742846 20:45413893-45413915 TGGAGATGGGCAATTTCAAAAGG + Intergenic
1178576218 21:33794157-33794179 TTGACATGACTGATTTCCAAAGG - Intronic
1179563534 21:42232253-42232275 TGGACAGGCTTCATATCCAAGGG + Intronic
1181687756 22:24541358-24541380 GGGAAATGGGTCATTTTCAAAGG - Intronic
1182068995 22:27450223-27450245 TGGAGATGGGAAAATTCCAAGGG - Intergenic
1185058804 22:48594909-48594931 GGGACATGGGGCAGTCCCAAGGG - Intronic
1185080819 22:48708471-48708493 TGGACATGGGCCTTTTCTGAAGG + Intronic
952525906 3:34210476-34210498 TGGACATGGGTCATTTCTCACGG + Intergenic
955263880 3:57422736-57422758 TGTACATGTGTCATTTTCACAGG - Intronic
955946487 3:64199286-64199308 TGGTCATGGGCCATATCCAGTGG - Intronic
956128669 3:66035164-66035186 TGGACTTGGTTCATTTTAAATGG - Intronic
958723354 3:97873772-97873794 GGAACATGGGTAATTTTCAATGG - Exonic
959186877 3:103056199-103056221 TGGACATGGGGAATTTACCATGG + Intergenic
963295488 3:143541626-143541648 TGGACATGGGTCATTGCTCAAGG - Intronic
964001052 3:151772256-151772278 TGGACTTGGGTCAGTTTCACTGG + Intergenic
964690930 3:159448849-159448871 TGGACATGAGTAACTTCCCAAGG - Intronic
964961293 3:162430285-162430307 TGGACATGAATCATTCTCAAGGG + Intergenic
965381333 3:167992533-167992555 TGGACCTGAGTCTTTTACAATGG + Intergenic
965424121 3:168499814-168499836 TGGACATGGGATAATTCCCACGG + Intergenic
967563793 3:190949970-190949992 TGGATAAAGGTCATTTTCAAAGG + Intergenic
968428112 4:536259-536281 CGGACATGGAGCCTTTCCAAGGG + Intronic
970083527 4:12318352-12318374 TGTACTTAAGTCATTTCCAAAGG + Intergenic
970765073 4:19538612-19538634 TGGACAGAAGTCATTTCGAAAGG + Intergenic
970822122 4:20229947-20229969 TTTACATGGATCATGTCCAAGGG - Intergenic
972826151 4:42761455-42761477 TGGACATTGGACTTATCCAAAGG - Intergenic
974566178 4:63580381-63580403 TGCACATTGGTCTTATCCAAAGG - Intergenic
974640483 4:64624154-64624176 TGAAAATGGGTGAATTCCAAGGG + Intergenic
977120268 4:93091042-93091064 TGAACATGGCTGAGTTCCAATGG - Intronic
977408977 4:96636966-96636988 TTGAAAAGGGTCATCTCCAAAGG - Intergenic
977732276 4:100368093-100368115 TGGAGATGGGGCTTTTACAAAGG + Intergenic
978809351 4:112833056-112833078 TGGACATGGGACAGTTTGAAAGG + Intronic
980108486 4:128611475-128611497 TGTGCATGTGTCATTTTCAATGG + Intergenic
983636101 4:169899279-169899301 TGGAATTTGTTCATTTCCAAGGG - Intergenic
983796672 4:171872794-171872816 TGGAAATGGGACCTTTACAAAGG - Intronic
986884982 5:12223083-12223105 AGCACATGGGTCATTCTCAAGGG - Intergenic
988876627 5:35454203-35454225 TGGACATTAGTCATGTCTAATGG + Intergenic
990066551 5:51722671-51722693 TGGATTTGGGCCATTTCAAAAGG + Intergenic
992142835 5:73816737-73816759 TGGACATGGGTCATTTCCAAAGG - Intronic
992144404 5:73830883-73830905 GGGACATGTGACATTTCTAATGG + Intronic
992883115 5:81130383-81130405 TGCACAGGGGTCAGTTTCAATGG + Intronic
993027276 5:82661347-82661369 TGAACATGGTTCATATGCAATGG - Intergenic
995702145 5:114948110-114948132 TGGAGATGGTTCATTTCCCAGGG - Intergenic
997616182 5:135247666-135247688 AGGAGATGGGTCATTTCAAATGG + Intronic
998778210 5:145627342-145627364 TGGACATGGGAAACTTCAAAAGG + Intronic
999872393 5:155765999-155766021 TGGCCTTGGGTCATTTTAAAGGG + Intergenic
1008304993 6:49890018-49890040 TGAAAATGGGTGAATTCCAAGGG + Intergenic
1008943394 6:57071295-57071317 TGAAAATGGGCGATTTCCAAGGG - Intergenic
1013400374 6:109789611-109789633 TGGACTTGGATCAATTCCAACGG - Exonic
1013460530 6:110371053-110371075 TTGACATGGGTAAATTCCCAGGG + Intergenic
1016138912 6:140583779-140583801 AGGACATGGAACATTTTCAAAGG + Intergenic
1016375901 6:143420266-143420288 TAGTAATAGGTCATTTCCAAAGG + Intergenic
1018228226 6:161650899-161650921 TGGTTATTTGTCATTTCCAAGGG + Intronic
1020920882 7:14262848-14262870 TGAACAAGGGTCATTGCCCAGGG + Intronic
1022218531 7:28289564-28289586 TAGCCACGGATCATTTCCAAGGG + Intergenic
1022910939 7:34899046-34899068 CGGTGCTGGGTCATTTCCAACGG + Intergenic
1027132938 7:75604294-75604316 TGGACATGGTTAAGTTCCAGGGG + Intronic
1027948682 7:84784048-84784070 TTTACATGGGTCATCTGCAATGG + Intergenic
1030529446 7:110695030-110695052 TGTACATTGGTCATTGCCAGGGG + Intronic
1030555526 7:111019733-111019755 TGGTAGTGGGTCCTTTCCAAAGG - Intronic
1031516166 7:122701856-122701878 TGCACATGGGACATGTCCTATGG + Exonic
1035328701 7:158082713-158082735 TGGACATGGTGCATTTTCCAAGG - Intronic
1035642999 8:1198022-1198044 CGGCCATGGCTCATTTCCAGTGG - Intergenic
1038551388 8:28472386-28472408 TGGATATGGGTCAGGTGCAATGG - Intronic
1040359661 8:46653001-46653023 TGAAAATGGGTGAATTCCAAGGG - Intergenic
1040581456 8:48701908-48701930 AGGACATTTGTCATTTGCAAAGG + Intergenic
1044731952 8:95236100-95236122 AAAACATGGGTCATTTCCTAAGG - Intergenic
1045298923 8:100894000-100894022 TGGACCTGGCTCACTTCCAGTGG - Intergenic
1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG + Intergenic
1047698431 8:127426819-127426841 TTGTCTTGGGACATTTCCAAGGG - Intergenic
1048847791 8:138616552-138616574 AGGACATGGGTGATTTCCCAAGG - Intronic
1049648309 8:143747810-143747832 TGTACATGGGATATTTTCAAGGG - Intergenic
1050925577 9:11259194-11259216 TGAAAATGGGTGAATTCCAAGGG + Intergenic
1051153714 9:14116148-14116170 TGGACATTTCTCATTTCCTATGG + Intronic
1052661169 9:31434072-31434094 TAAACATGTGTAATTTCCAAAGG - Intergenic
1058584964 9:106497676-106497698 TGGAAATGGGACATGTGCAAAGG + Intergenic
1185756403 X:2656476-2656498 TGGACCTGGGAGCTTTCCAAAGG + Intergenic
1186381137 X:9060596-9060618 TGCATATTGGTCATTTGCAATGG - Intronic
1193418834 X:81258637-81258659 TGGCCATGGGCCATTTCTAAGGG + Intronic
1193652565 X:84156074-84156096 TGGTCAGGGGTCATTTGGAAAGG - Exonic
1198520686 X:137449342-137449364 AGGACATGAGTCATTTCTAGGGG + Intergenic
1199808099 X:151322026-151322048 TGATCATGGGTGATTTCCCATGG + Intergenic
1201620486 Y:15951640-15951662 TTGACATGGGCAAATTCCAAGGG + Intergenic
1201620520 Y:15951954-15951976 TGGACATGGGATATTTCTCAGGG + Intergenic