ID: 992143309

View in Genome Browser
Species Human (GRCh38)
Location 5:73820649-73820671
Sequence GCATCTAGGTCAGCAGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992143309_992143321 27 Left 992143309 5:73820649-73820671 CCCCTGGCTGCTGACCTAGATGC 0: 1
1: 0
2: 4
3: 10
4: 148
Right 992143321 5:73820699-73820721 CTCTTCCTTCGCACTATGGTGGG No data
992143309_992143320 26 Left 992143309 5:73820649-73820671 CCCCTGGCTGCTGACCTAGATGC 0: 1
1: 0
2: 4
3: 10
4: 148
Right 992143320 5:73820698-73820720 TCTCTTCCTTCGCACTATGGTGG No data
992143309_992143319 23 Left 992143309 5:73820649-73820671 CCCCTGGCTGCTGACCTAGATGC 0: 1
1: 0
2: 4
3: 10
4: 148
Right 992143319 5:73820695-73820717 TGGTCTCTTCCTTCGCACTATGG 0: 1
1: 0
2: 0
3: 7
4: 133
992143309_992143315 3 Left 992143309 5:73820649-73820671 CCCCTGGCTGCTGACCTAGATGC 0: 1
1: 0
2: 4
3: 10
4: 148
Right 992143315 5:73820675-73820697 CCCCAGAAACGTCTGCCATCTGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992143309 Original CRISPR GCATCTAGGTCAGCAGCCAG GGG (reversed) Intronic
900001556 1:17498-17520 GCACATAGGCCAGGAGCCAGGGG - Intergenic
900021276 1:188022-188044 GCACATAGGCCAGGAGCCAGGGG - Intergenic
900247276 1:1642642-1642664 GCATCGGGGTCAGAGGCCAGAGG + Intronic
900258500 1:1709774-1709796 GCATCGGGGTCAGAGGCCAGAGG + Intronic
900378635 1:2372960-2372982 GCATCTGAGTCAGCACCCTGAGG + Intronic
901932900 1:12608336-12608358 GCATCCAGTTCAGAAGCCACAGG + Intronic
902538981 1:17138969-17138991 GCACCTTGGGCAGCAGCCAGTGG + Intergenic
904402250 1:30264443-30264465 GCCTCTAGGGCAGCAGCACGTGG - Intergenic
904616130 1:31750901-31750923 GTAGATAGGTCAGCAGCCTGGGG - Intronic
904788563 1:33000516-33000538 GCAGCTAGGGAAGCAGGCAGAGG - Intergenic
906317783 1:44799615-44799637 GGGCCTGGGTCAGCAGCCAGAGG - Intergenic
907126765 1:52056893-52056915 GCCTGTCGGTCAGCAGGCAGTGG - Intronic
909463335 1:75943940-75943962 GCATCTTGCTCAGATGCCAGTGG - Intergenic
910629748 1:89342636-89342658 GCAGCTAAATCAGCAGCAAGGGG + Intergenic
914508268 1:148307972-148307994 GCATCTAGATGCGCAGCCTGGGG + Intergenic
915284225 1:154842567-154842589 GCACTTAGGGAAGCAGCCAGTGG - Intronic
915942982 1:160130544-160130566 GCATCTGGCACAGCAGCCCGGGG - Exonic
917660232 1:177170871-177170893 GCATGTAGGTTGGCAGCCAATGG - Intergenic
918096104 1:181335466-181335488 ACATCTAGGCCAGCAACCAGAGG - Intergenic
919838130 1:201590696-201590718 GCATCTAGGCCAGGAGCCAGTGG + Intergenic
920125963 1:203693955-203693977 GTATCTAGGTTGGCATCCAGTGG + Intronic
920348935 1:205324843-205324865 CCATCTAGGTGAGGAGCCATGGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1068135326 10:52947450-52947472 ACAGCTGGGTCAGCAGCCATCGG - Intergenic
1068309857 10:55263348-55263370 GCATTTCGCTCAGCAGCCAAGGG + Intronic
1076078323 10:127555307-127555329 GAATCTAAGCCATCAGCCAGTGG + Intergenic
1077907317 11:6544555-6544577 GCACCTGTGTAAGCAGCCAGAGG - Exonic
1078633470 11:13027835-13027857 GCCTCTAGGTCCTCAGCCAGTGG - Intergenic
1079328457 11:19514144-19514166 GCACCTAGGTCTGCAGGCTGGGG + Intronic
1083257413 11:61505281-61505303 TCATCTTATTCAGCAGCCAGGGG + Intergenic
1088287347 11:108202334-108202356 GCAGCTAAGTCGGCAGCAAGAGG + Intronic
1089674446 11:120080551-120080573 GCAGCTAGGGCAGCACCCATGGG - Intergenic
1091042766 11:132297432-132297454 GCCTCTAGTTCATCAGCCAGTGG + Intronic
1091054185 11:132402955-132402977 GAATCTAAGTCGGCAGCCAGAGG - Intergenic
1098965802 12:76786865-76786887 GCATCTAGTTCAGCAGGCAACGG - Intronic
1101315970 12:103629150-103629172 GCAACTAGGCCAGCAGCCAGGGG - Intronic
1106001262 13:25725494-25725516 GCATCAAGGACAACAGACAGGGG + Intronic
1107879844 13:44823331-44823353 GCATCTATGTCAGCGAGCAGAGG + Intergenic
1109007756 13:56900856-56900878 GCACCCAGGCCAGCAGCCTGGGG + Intergenic
1111135522 13:84037401-84037423 GCATCTATGTCAGTGGGCAGAGG + Intergenic
1117554467 14:56870228-56870250 TCATATAGGTCAGCCTCCAGAGG - Intergenic
1118435994 14:65771308-65771330 TCTTCTAGGTGAGCAGCCAAGGG + Intergenic
1120442741 14:84560265-84560287 GCAGCTAAGTCAGCAGGAAGAGG - Intergenic
1122193501 14:100067200-100067222 GCTGCAAGGTCAGCAGCCATAGG + Intronic
1123061976 14:105598525-105598547 GCACCCAGGGCAGGAGCCAGAGG - Intergenic
1127137502 15:55939857-55939879 ACTTCTAGGTATGCAGCCAGAGG + Intronic
1132451953 15:101973438-101973460 GCACATAGGCCAGGAGCCAGGGG + Intergenic
1133012578 16:2922692-2922714 GCATCCTGATCAGGAGCCAGTGG + Intronic
1133054226 16:3137493-3137515 GCAGCTCGGGCCGCAGCCAGCGG - Exonic
1140172119 16:72616648-72616670 GGCTCAATGTCAGCAGCCAGAGG + Intergenic
1140875575 16:79149718-79149740 ACATTTAGGACCGCAGCCAGTGG + Intronic
1143092009 17:4454388-4454410 GCATCTGTGTCTGCAGCCACAGG - Intronic
1143234825 17:5390486-5390508 GAATTTATGTCAGCATCCAGAGG + Intronic
1144201640 17:12947411-12947433 GCCCCTAGGTCAGAGGCCAGAGG - Intronic
1144301731 17:13927674-13927696 GCAGCTAAAACAGCAGCCAGGGG + Intergenic
1145960079 17:28882103-28882125 ACATCAAGGTGAGCAGCCTGAGG - Exonic
1147515982 17:41118004-41118026 GCATCTGGGGCGGCAGCAAGTGG + Exonic
1158947428 18:62459096-62459118 GCATCAATCTCAGCAGCCAGTGG - Intergenic
1160419080 18:78731897-78731919 GCATCTCTTGCAGCAGCCAGTGG - Intergenic
1161191410 19:2959068-2959090 GCTTCTAGCTCAGCAGACTGGGG - Intergenic
1161277146 19:3424919-3424941 CCCTCTAGGGCAGCAGCCAAGGG + Intronic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1165814379 19:38632641-38632663 GCATCTCGGCCAGCAGCCAGCGG - Exonic
1168404374 19:56103124-56103146 GAACCCAGGTGAGCAGCCAGAGG - Exonic
1168681203 19:58317208-58317230 GCTTCAAGGACAGCAGCCACAGG - Intergenic
925185272 2:1842628-1842650 GCAGGCAGGTCAGGAGCCAGAGG - Intronic
927010413 2:18898113-18898135 GAATCTACGTCATCAGCCAAAGG - Intergenic
927085374 2:19669931-19669953 GCACCCCGGGCAGCAGCCAGTGG - Intergenic
928946963 2:36780202-36780224 GCTTCTAGGACAGGAGCAAGAGG + Intronic
931872033 2:66471669-66471691 TCATTTAGCTCTGCAGCCAGAGG + Intronic
932353495 2:71050120-71050142 CCATCTAGGTCAGGAGTCACTGG + Intergenic
934146044 2:89094867-89094889 GCAGCTAGGTAAGAATCCAGTGG + Intergenic
934147769 2:89112237-89112259 GCAACTAGGTGAGAACCCAGTGG + Intergenic
934221506 2:90088371-90088393 GCAACTAGGTGAGAACCCAGTGG - Intergenic
935572737 2:104678619-104678641 GCATCTTAATCAGGAGCCAGTGG - Intergenic
936252202 2:110875614-110875636 GGATCGAGGTGAGCAGCAAGGGG - Intronic
940872252 2:158869757-158869779 GCATGTAGGTCAGGAGTCACTGG + Intergenic
942115742 2:172727256-172727278 GCCTCTGGGTCATCAGGCAGAGG + Intergenic
946434124 2:219640770-219640792 TCACCTAGGGGAGCAGCCAGTGG - Exonic
948125425 2:235561485-235561507 CCCTCCAAGTCAGCAGCCAGAGG - Intronic
948700791 2:239758419-239758441 GTAAATAGGTCAGCAGCCCGGGG - Intergenic
1170304120 20:14918499-14918521 GCATGTAGGTCAGCTGGCACAGG + Intronic
1171113813 20:22507436-22507458 GGACCTAGGTGAGCAGGCAGAGG + Intergenic
1171953306 20:31440532-31440554 TCATTTAGGTCAGCAGGGAGAGG - Exonic
1171971670 20:31568870-31568892 GCAGCAAGGGCAGCAGCCAATGG - Intronic
1174782152 20:53399716-53399738 GCAGCCAGGTCAGCAGCGACTGG - Intronic
1175190662 20:57210449-57210471 GCCTCTAGGTAGGTAGCCAGAGG - Intronic
1177125061 21:17184214-17184236 GCAGCTAAGTCAGCAGAGAGAGG + Intergenic
1177189096 21:17829853-17829875 GCATCCAGCTCAGCATCCATAGG + Intergenic
1177550189 21:22611008-22611030 GCATCTATGTCAGTAAGCAGAGG + Intergenic
1178685753 21:34709413-34709435 GCATCTATTTCATCAGGCAGAGG - Exonic
1180099600 21:45578350-45578372 GCAGCGAGGCCAGCAGGCAGAGG + Intergenic
1180625509 22:17191040-17191062 GCTGCAAGGGCAGCAGCCAGTGG - Intronic
1180905395 22:19407034-19407056 GCATGTAGGTCAGGAGCAGGTGG - Intronic
1181030965 22:20148784-20148806 GCCTCAGGGTCAGCAGCCTGCGG + Exonic
1181259345 22:21586232-21586254 AAATCTAGGCCAGGAGCCAGGGG - Intronic
1183978219 22:41525341-41525363 TCATCAAGGTCAGCAGCATGGGG + Exonic
1184294692 22:43516005-43516027 GCAACCAGGGCAGCTGCCAGGGG - Intergenic
1185046869 22:48533011-48533033 GCATTTAGGGCAACAGCCTGGGG - Intronic
954744884 3:52782077-52782099 GCTTCTGGCTCAGCACCCAGAGG + Intronic
954839042 3:53495199-53495221 GCATCAACGGCAGCAGCAAGCGG + Exonic
955201641 3:56856982-56857004 GCATCCAAGTCTGCAGCCATGGG + Intronic
957625501 3:82648696-82648718 GCAGCTAAGTCAGCAGCAAGAGG + Intergenic
960986624 3:123285272-123285294 GCATCTAAGTCACGAGCCTGAGG + Intronic
962769041 3:138594982-138595004 CCATCTAGGGCATCAGCCAAGGG + Intergenic
964449373 3:156796394-156796416 GCTTCTAGATATGCAGCCAGAGG + Intergenic
965634258 3:170765360-170765382 GACTCTAGATCTGCAGCCAGAGG - Intronic
967191739 3:186990858-186990880 GCATCTAGGTCAGCTGCTCCTGG - Intronic
968874050 4:3255958-3255980 GCGTCTAGGCCAGCAGGCGGCGG + Exonic
968994794 4:3938649-3938671 GCTTCTAGGTGAGAGGCCAGCGG + Intergenic
970174531 4:13325919-13325941 GCATGTGTGTCAGAAGCCAGTGG - Intergenic
974250543 4:59378010-59378032 GCATCTGGCTCAGCCGCCAAAGG - Intergenic
976214889 4:82706769-82706791 GCTCCTAGGTCAGCAACCAGTGG - Intronic
977474565 4:97489351-97489373 GCATCTGGGTCAGAAATCAGAGG + Intronic
980893914 4:138843065-138843087 GCATCTAAGGCAGTACCCAGTGG - Intergenic
981694984 4:147550975-147550997 GGAACTCGGGCAGCAGCCAGAGG + Intergenic
985632074 5:1018940-1018962 GCATCTAGGGGAGCAGCAGGTGG + Intronic
987246771 5:16056929-16056951 GCATCTAGGTCGCCAGACATAGG + Intergenic
989294982 5:39814838-39814860 GAGTCCAGGTAAGCAGCCAGAGG + Intergenic
992143309 5:73820649-73820671 GCATCTAGGTCAGCAGCCAGGGG - Intronic
994147364 5:96410243-96410265 GCATCTGGGTAAGCAGCTCGGGG - Intronic
994692155 5:103032836-103032858 GCATCTCGGCCAGCAGCCAGTGG - Intergenic
998404923 5:141868882-141868904 GCATCACGGTCTGAAGCCAGCGG + Exonic
999252088 5:150188815-150188837 CCATATGGGTCAGCAGGCAGGGG + Intergenic
1003618663 6:7677986-7678008 GCATTTAGGACACAAGCCAGTGG + Intergenic
1005410481 6:25539977-25539999 GCATCTTGGGCGGGAGCCAGTGG + Exonic
1007595206 6:43046865-43046887 GCATCCAGGTCAGGAGGAAGGGG - Exonic
1008110396 6:47486280-47486302 GCATTTATGTCAGAACCCAGGGG - Intronic
1011989809 6:93500367-93500389 TGATGTAGGCCAGCAGCCAGAGG - Intergenic
1013077297 6:106782654-106782676 ACAGCTGGGGCAGCAGCCAGAGG - Intergenic
1013500895 6:110750333-110750355 GAAACTAGGCCAGCAGCCAGAGG + Intronic
1017917514 6:158843285-158843307 TCACCTAGGTCACCAGGCAGAGG + Intergenic
1019043196 6:169123016-169123038 GCAGCTAAATCAGCAGCAAGGGG + Intergenic
1022213139 7:28231638-28231660 GAATTTAGTTAAGCAGCCAGAGG - Intergenic
1023066854 7:36386797-36386819 GGAACTAGAGCAGCAGCCAGGGG + Intronic
1023773700 7:43583360-43583382 GTATCTCTGTCAGCAGCCCGCGG - Exonic
1024946875 7:54817249-54817271 GCATCTAGCTCAGTAAGCAGAGG - Intergenic
1032749162 7:134819716-134819738 ACATCTGGGTCAGGAGCTAGAGG - Intronic
1035293180 7:157853072-157853094 GCCTCCAGATCAGCAGGCAGTGG + Intronic
1036014496 8:4767478-4767500 GCAGGTAGACCAGCAGCCAGCGG - Intronic
1036905942 8:12708520-12708542 CCATCTAGGTCAGGAGTCACTGG - Intergenic
1040285414 8:46098172-46098194 GCATCCAGGGCTGGAGCCAGAGG - Intergenic
1044171658 8:89060403-89060425 TCATCTATGGCAGCAGCAAGAGG - Intergenic
1045319613 8:101072026-101072048 GCAGCTGGGGCAGCAGGCAGAGG - Intergenic
1049151580 8:141038470-141038492 GCCTGGAGGTCAGCGGCCAGGGG - Intergenic
1049884364 9:17611-17633 GCACATAGGCCAGGAGCCAGGGG - Intergenic
1059929710 9:119248941-119248963 GGAGGTAGGTCAGCAGCCACTGG - Exonic
1061151119 9:128828932-128828954 GCTGCTGGGTGAGCAGCCAGAGG + Intronic
1062035356 9:134380352-134380374 GAACCTGGGTCAGGAGCCAGGGG + Intronic
1186362522 X:8857123-8857145 GCACCAGGGTCTGCAGCCAGTGG + Intergenic
1186604686 X:11077889-11077911 CCATTTAGGTCAGCCCCCAGGGG - Intergenic
1189413455 X:40793574-40793596 GCAGCTAAATCAGCAGCAAGGGG - Intergenic
1189636067 X:43010734-43010756 TCATCTAGGTCAGAATGCAGTGG - Intergenic
1190066887 X:47247626-47247648 GCAACAAGGACAGCGGCCAGTGG + Exonic
1192560561 X:72125344-72125366 GCCTCTAGGTCTCCATCCAGTGG + Intergenic
1195010992 X:100731985-100732007 ACAGGTAGGTCAACAGCCAGCGG - Intronic
1199607252 X:149586647-149586669 GCATCAAGGTCAGAACCCTGAGG - Intronic
1199622434 X:149712843-149712865 GCATCAAGGTCAGGACCCCGAGG + Intronic
1199628774 X:149762084-149762106 GCATCAAGGTCAGGACCCCGAGG - Intergenic
1199631871 X:149782720-149782742 GCATCAAGGTCAGAACCCTGAGG + Intronic
1199954967 X:152735246-152735268 GCATCCAGGTGAGAAGCCTGAGG + Exonic
1200089561 X:153627964-153627986 GCAGCGAGGGCGGCAGCCAGGGG + Intergenic
1200401441 X:156022545-156022567 GCACATAGGCCAGGAGCCAGGGG + Intergenic