ID: 992150468

View in Genome Browser
Species Human (GRCh38)
Location 5:73897355-73897377
Sequence CACCTGTTCTAGGGGATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992150468 Original CRISPR CACCTGTTCTAGGGGATATT GGG (reversed) Intronic
900385925 1:2410704-2410726 CAACTGTTCTAGGGCCTATGAGG + Intronic
900699701 1:4038232-4038254 TACCAGTTCTAGGAGCTATTTGG - Intergenic
903425411 1:23250566-23250588 CATCTGTAATAGGGGATAATAGG - Intergenic
906956043 1:50375051-50375073 CACCAGTTCTAGGAGCTTTTTGG - Intergenic
909663731 1:78111231-78111253 AAACTGTAATAGGGGATATTGGG + Intronic
920572686 1:207029590-207029612 CATCTGTTCTAGGGTCTATTAGG + Intronic
922461262 1:225815954-225815976 CTCCTATTCCAGGGGATAATAGG - Intronic
1063810556 10:9700452-9700474 CATCTGTTCTAGGTGATAGCTGG - Intergenic
1063982118 10:11462794-11462816 CACTGGTGCTGGGGGATATTCGG - Exonic
1065312410 10:24429235-24429257 TACCTGTTCTGGGGGCTTTTAGG + Intronic
1070528865 10:77318754-77318776 CACCTGTGCTTAGGGACATTTGG - Intronic
1072132593 10:92509973-92509995 CACCTGTTCTATGGTAAACTAGG + Intronic
1073025427 10:100483943-100483965 CACTTATTCTTGAGGATATTCGG + Intergenic
1073631915 10:105157738-105157760 TTCCTGTTGTATGGGATATTGGG + Intronic
1079487384 11:20949633-20949655 CACCTGTTCTATTGTAAATTGGG - Intronic
1079742595 11:24081790-24081812 GACCTGTTTTAGGGCATTTTAGG + Intergenic
1082301974 11:50517548-50517570 CACATCTGCTAAGGGATATTTGG - Intergenic
1093604178 12:21069919-21069941 CACCAGCTCTAGGGGCTTTTTGG + Intronic
1107641642 13:42449843-42449865 CATCTGTTCCAGGGGTTTTTTGG - Intergenic
1110375664 13:74790969-74790991 TACCAGTTCTAGGGGCTTTTTGG + Intergenic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1112767699 13:102763300-102763322 CCCCTGTCTTAGGGGATATTTGG - Intergenic
1119126350 14:72130780-72130802 AACCTGCTCTAGGGGAAAGTGGG - Intronic
1120504941 14:85343850-85343872 AACCTGTTCTATGAGATATGTGG - Intergenic
1120897756 14:89549543-89549565 CTTCTGTTTTGGGGGATATTGGG - Intronic
1126878155 15:53066350-53066372 TACCTGTTTTAAGGGATTTTGGG - Intergenic
1127110001 15:55658708-55658730 CAACTTTTCTAGGGGTAATTGGG - Intronic
1135541841 16:23336042-23336064 CACCTGTTCTGGTGGGTGTTGGG - Intronic
1136630167 16:31485326-31485348 CTCCTGTTGGAGGGGAGATTGGG + Intronic
1146424831 17:32727325-32727347 GAGCTGTTCTAAGAGATATTTGG - Intronic
1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG + Intronic
1151062759 17:71115051-71115073 CACCTGCTCAAGGGGATAGTGGG - Intergenic
1153212318 18:2780586-2780608 CTCCTGTTCAATGAGATATTTGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157543905 18:48534388-48534410 CACCCGATCTATGGGATCTTGGG - Intergenic
1157692209 18:49692633-49692655 CCCCTGGTCTAGGGCATATTGGG + Intergenic
1159554458 18:69930780-69930802 CACCTGTACTATGGGAATTTAGG - Intronic
1160375229 18:78406348-78406370 CAGCTGTTCTAGGGGGGATTTGG - Intergenic
1162153872 19:8663824-8663846 CACCTGCTCTGGGGGATGTAGGG + Intergenic
1162174989 19:8823796-8823818 CACCTGCTCCAGGGGACATTCGG + Intronic
1163594224 19:18211536-18211558 CATCTGTTCTAGGTGACATGCGG - Intronic
1163823234 19:19508230-19508252 CGCCTGTTGTAGGGGAGGTTGGG + Exonic
1164235245 19:23326149-23326171 TACCTTTTCTAGGGAAAATTAGG + Intronic
925821362 2:7802715-7802737 CACCTGTTCTTGGATCTATTGGG + Intergenic
926044945 2:9703522-9703544 AACTTGTTCCAGGGGATATTTGG + Intergenic
930620176 2:53635403-53635425 CACCAGTTCTATGGAACATTTGG - Intronic
934935252 2:98460629-98460651 CACCAGTTTTAGGGGATTGTGGG + Intronic
938630791 2:133165024-133165046 CCCCTCTTCTAGGTGACATTTGG + Intronic
941898397 2:170653651-170653673 ATCCTGTTCTAGGAGATCTTGGG - Exonic
943677344 2:190728878-190728900 CTCCTTTCCTAGGGGATGTTAGG + Intergenic
1172495554 20:35380994-35381016 AACCTGTTCTAGGAGATAAGTGG + Intronic
1172516839 20:35540875-35540897 CACCCATTCTATGGAATATTAGG - Intergenic
1176243439 20:64085368-64085390 CACCTCTTCTAGGGCAAGTTTGG + Intronic
1177421722 21:20867862-20867884 CTCCTCTGCTAGGTGATATTGGG + Intergenic
1177967536 21:27746736-27746758 CACCAGTTCTATGGGACAATTGG + Intergenic
1180931228 22:19593277-19593299 CACCTGTTCTGGGAGATGCTCGG + Intergenic
1181373318 22:22435738-22435760 TACCAGTTCTAGGAGATTTTTGG + Intergenic
949689729 3:6621810-6621832 CTCCTCTTCTAGTGAATATTAGG - Intergenic
951630614 3:24716276-24716298 CACCAGTTCAGGGGGACATTAGG + Intergenic
953654336 3:44837132-44837154 CATCAGTTCTAGGGGACAGTTGG + Intronic
957801185 3:85084406-85084428 CAACTGTTCAAGGTGATAATTGG - Intronic
960550457 3:118970381-118970403 GACCTGAACTAGGGGATCTTTGG + Intronic
963325006 3:143852644-143852666 CACCTGCACTAGAGGCTATTTGG + Intergenic
963341661 3:144042442-144042464 CACTTGTTCAATGGGATACTAGG + Intronic
963490323 3:145992172-145992194 CACCTGTTATAGAGCATATTGGG - Intergenic
968291310 3:197541863-197541885 CAGCTGTTCACAGGGATATTGGG - Intronic
969626058 4:8306348-8306370 CATCTGTACAAGGGGATGTTGGG - Exonic
969818926 4:9706200-9706222 CACTTGTGCTTGGTGATATTGGG - Intergenic
973212392 4:47631219-47631241 CCCCTGTCCTAGGGGACATTTGG - Intronic
973284163 4:48396622-48396644 CACCTGTTCACAGGTATATTTGG + Intronic
976526532 4:86098585-86098607 CTCCTGTTCTAGTGGATATATGG - Exonic
977444935 4:97119027-97119049 CATCTGTTCTAGGAGCTTTTTGG - Intergenic
977481032 4:97575878-97575900 CATCAGTTCTAGGGGCTCTTTGG - Intronic
979853932 4:125608975-125608997 AAGCTGTTCTGGGGGATGTTTGG + Intergenic
984529679 4:180901439-180901461 CACCTGTTCTGGGGCAGAGTGGG - Intergenic
985246851 4:187987544-187987566 AACCTGTTCTAAGGCACATTTGG + Intergenic
988002521 5:25366891-25366913 TACCAGTTCTAGGGGATTTTTGG - Intergenic
990364261 5:55053766-55053788 CAGCTGTTCTGGGGGATGGTCGG - Intergenic
992150468 5:73897355-73897377 CACCTGTTCTAGGGGATATTGGG - Intronic
997263941 5:132484065-132484087 CACATCTTCTAGGGGATATTGGG - Exonic
998403279 5:141859150-141859172 CACCTGGTGTAGGGGTGATTAGG + Intronic
1003058006 6:2840797-2840819 CAGCAGTTATAGGGGATTTTAGG + Intronic
1008784111 6:55144715-55144737 CCCCTGGTCTAGAGGATCTTTGG + Intronic
1009628296 6:66164296-66164318 CACCTGTGCTAGGAGACTTTTGG + Intergenic
1016167419 6:140964038-140964060 TACCTGTTCTAGGAGCTTTTTGG + Intergenic
1016430898 6:143984289-143984311 CACCAGTTCAATGGTATATTTGG + Intronic
1017126639 6:151070859-151070881 CACCAGTACTTGGGGATACTGGG - Intronic
1019102068 6:169639781-169639803 CAGCCGTTCTAGGGGTTATGAGG - Intronic
1027487017 7:78774287-78774309 AAGCTGTTGTAGAGGATATTTGG + Intronic
1030059354 7:105610668-105610690 CACATGTTCTAGGGGAAAGAAGG + Intronic
1030764224 7:113389286-113389308 CATCTGTTCCATGGGATATTTGG - Intergenic
1033093265 7:138406295-138406317 CACCTGGTCCAGGGGAATTTAGG - Intergenic
1034083518 7:148302482-148302504 CACATGGCATAGGGGATATTGGG - Intronic
1035786368 8:2264344-2264366 CACCTGTTATCAGGGGTATTTGG + Intergenic
1035806439 8:2457372-2457394 CACCTGTTATCAGGGGTATTTGG - Intergenic
1036962731 8:13263157-13263179 CACTTGTTCAAGGGAATCTTTGG + Intronic
1039389719 8:37168390-37168412 CATCAGTTCTATGGGACATTTGG + Intergenic
1045155659 8:99467394-99467416 CACCTGATATAGGGGATAAAAGG - Exonic
1047307896 8:123668017-123668039 CATCAGTTCTAGGGGACAATTGG + Intergenic
1052574449 9:30274035-30274057 CACCTTTTCTATGTGCTATTTGG + Intergenic
1054902086 9:70379761-70379783 CAACTTTTCTAGGAGATAATTGG - Intergenic
1055175725 9:73315100-73315122 CACCTGTTCTGGGAGAGAATTGG - Intergenic
1056536152 9:87529560-87529582 CACATGCTCTGGGGGATATATGG + Intronic
1057878107 9:98772920-98772942 CACCTCTTCTAGGGCAGAATGGG + Intronic
1192610052 X:72558853-72558875 TACCAGTTCTAGGAGCTATTTGG - Intronic
1193578571 X:83233105-83233127 CACCTGTTCTGGTGGAGGTTGGG - Intergenic
1195376146 X:104230056-104230078 GACCTGTACTAAGGAATATTAGG + Intergenic
1197576064 X:128212826-128212848 TACCAGTTCTAGGAGATTTTCGG - Intergenic
1198029650 X:132742609-132742631 CACCTGTTGTTGGGAAGATTTGG - Intronic