ID: 992153173

View in Genome Browser
Species Human (GRCh38)
Location 5:73926495-73926517
Sequence GTGCAGGTGAACCAAAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992153173 Original CRISPR GTGCAGGTGAACCAAAGGGT AGG (reversed) Intronic
901923436 1:12551892-12551914 GTGCAGGTGAGACAGAGGGGAGG + Intergenic
902735965 1:18400907-18400929 GTGCAGGTGTGCCCAGGGGTGGG - Intergenic
906246932 1:44282910-44282932 GTGCTGCTGGCCCAAAGGGTGGG - Intronic
907470704 1:54671637-54671659 GTGGAGGTGACCCTCAGGGTAGG + Intronic
908412024 1:63876363-63876385 GTGCAAGTGATGCACAGGGTGGG - Intronic
913244738 1:116861574-116861596 GTGTATGTGAACAAAAGAGTTGG + Intergenic
921685091 1:218080932-218080954 GTGCAAGTGAACCAGAGGCGGGG + Intergenic
922586273 1:226737016-226737038 GTGCAGGTGAACCAGAAAGTGGG - Exonic
922739666 1:228007995-228008017 GTGCAGATAAACCAAAGGAAGGG + Intronic
923226207 1:231941045-231941067 ATGCAGGTGAACAGATGGGTGGG + Intronic
1062793735 10:326422-326444 GTGCTGGTGAGGCAAACGGTTGG - Intronic
1063454752 10:6175178-6175200 GTGCATGGGAACCAAAGAGGGGG - Intronic
1069310893 10:67034819-67034841 GTGCATCTGAAGCAAATGGTAGG - Intronic
1071702627 10:87956957-87956979 TAGCAGTTGAACCAAATGGTGGG - Intronic
1072726498 10:97817102-97817124 TTGCAGGTGAAGGAGAGGGTGGG + Intergenic
1074439233 10:113460595-113460617 GTGTATGTGATCCAATGGGTGGG + Intergenic
1074579331 10:114703441-114703463 GTAGAGGTGAAGCAAATGGTAGG + Intergenic
1076713824 10:132353341-132353363 GAGCAGGTGAGCCACAGGGGCGG - Intronic
1076939083 10:133589774-133589796 GTGCAGGTGAAACACAGAGAAGG - Intergenic
1077366300 11:2162663-2162685 GGGCAGGAGAGCCAAAGGCTGGG - Intergenic
1078427198 11:11261586-11261608 GAGCAGGTAAACCAAAGGAAGGG - Intergenic
1084769856 11:71335537-71335559 GTTCAGAAGGACCAAAGGGTGGG - Intergenic
1087150445 11:94854964-94854986 GTGCAGGTGAACCCCAGGCTGGG - Intronic
1087182091 11:95151083-95151105 GTCCAGGAGCTCCAAAGGGTAGG - Intergenic
1089399280 11:118155144-118155166 GAGGAGGTGAGCCAAAGGGAAGG + Intergenic
1089598753 11:119599925-119599947 GTGCATGTGAACAGAAGTGTGGG + Intergenic
1089846158 11:121460279-121460301 GTGGGGGTGAATCAATGGGTGGG + Intronic
1090924062 11:131234296-131234318 TCGCAGGTGAAACAAAGGGAAGG - Intergenic
1094171965 12:27503049-27503071 GTACAGGTGAGCCAAAGAGGTGG + Intergenic
1097249605 12:57625313-57625335 GTGCAGGTGAGGGAGAGGGTAGG + Exonic
1098226029 12:68325888-68325910 GTGCAGGTGAGGCAAAGTGCTGG - Intronic
1099083995 12:78222209-78222231 TTGCAGGTGAAGCTGAGGGTTGG - Intergenic
1102435228 12:112917588-112917610 GTGGTGGAGACCCAAAGGGTTGG + Exonic
1103845495 12:123899241-123899263 GTGCAGGTGACACAGAGGCTCGG - Intronic
1109280938 13:60354534-60354556 GTACAGGTGAACAGAGGGGTAGG + Intergenic
1113469733 13:110535842-110535864 TTGAAGGTGAACCAGAGGGCAGG + Intronic
1115956748 14:38789744-38789766 GTGCTGGTGCACCAGAGGTTGGG - Intergenic
1116502942 14:45642692-45642714 AGGCAGGTGAATCACAGGGTCGG + Intergenic
1118504958 14:66401137-66401159 GTGTATGTGAAGCAGAGGGTAGG - Intergenic
1118992385 14:70808861-70808883 GGGCAGCTGAACCAGCGGGTGGG - Exonic
1119109320 14:71956877-71956899 GTGAAGGTGAAGCGAAGGGTAGG + Intronic
1120717283 14:87853407-87853429 GTGTAGGAGAAACAAAGGCTGGG + Intronic
1121949935 14:98162914-98162936 GTGCAGCTGAACCGAAGAGAGGG - Intergenic
1125360874 15:38863424-38863446 ATGCCTGTGAACCAAAGGGTGGG - Intergenic
1126826826 15:52559824-52559846 GTGCAGGGAAACCCAAGAGTAGG - Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1134024437 16:10943126-10943148 GAGCAGGGGAACCAGTGGGTGGG - Intergenic
1141793422 16:86252147-86252169 GTGCAGGTGACCTCAAGGGAAGG - Intergenic
1145889622 17:28405664-28405686 TTGCAGGTTAACAAAAGGGGGGG - Intronic
1145899792 17:28483038-28483060 CTGAAGGTTAACCCAAGGGTGGG - Intronic
1151076687 17:71281476-71281498 GTGTCTGTGAACAAAAGGGTAGG + Intergenic
1151649823 17:75459914-75459936 GCACAGGTGAACTAGAGGGTAGG + Intronic
1153699111 18:7674552-7674574 GAGGTGTTGAACCAAAGGGTGGG + Intronic
1155915923 18:31557105-31557127 CTGCAGGTGAACCAGAGGTGTGG - Intergenic
1160936337 19:1597537-1597559 GAGCAGGTGAACCAAGGGAGAGG - Exonic
1163385888 19:17000359-17000381 GTGGAGGTGAACCTGGGGGTTGG + Intronic
925483211 2:4299778-4299800 GTGCAGTTGAACCACAGGCCAGG + Intergenic
926702646 2:15813961-15813983 GTGCATGAGGAGCAAAGGGTGGG - Intergenic
930221753 2:48753278-48753300 GTGCATGTTAAGCAAAGGGAGGG - Intronic
930266083 2:49200694-49200716 TTGCAGCAGAAACAAAGGGTTGG - Intergenic
938105354 2:128526315-128526337 GAGCAGGAGAACCAGAGGGAGGG - Intergenic
942459445 2:176159304-176159326 GGCCAGGTGAACAAAAGGATGGG + Intronic
946015776 2:216602873-216602895 GTGCAGGTGAAGGAAAGACTGGG - Intergenic
948916102 2:241035777-241035799 ATGCAGGTGCGCCACAGGGTTGG + Intronic
948916121 2:241035831-241035853 GTGCAGGCGCGCCACAGGGTTGG + Intronic
948916163 2:241035937-241035959 GTGCAGGTGTGCCACGGGGTTGG + Intronic
1175766310 20:61595135-61595157 GCTCAGGTGGACCCAAGGGTGGG - Intronic
1180432264 22:15263628-15263650 CAGCAGGTGAACCCCAGGGTCGG + Intergenic
1181468934 22:23126349-23126371 GTGCAGGTGAACTGCAGGGGAGG - Intronic
1185419922 22:50729450-50729472 GTGCAGGTGAACCACAAGCGTGG - Intergenic
952464091 3:33562651-33562673 GTGAAAGTGAACCAAAGAATAGG - Intronic
955942874 3:64163407-64163429 ATGCTGGTGAACCAGAGGGTAGG + Intronic
959917487 3:111832180-111832202 GTGGTGCTGTACCAAAGGGTTGG - Intronic
960163539 3:114376528-114376550 GGGCGGGTGAAGCAAATGGTTGG + Intronic
960203008 3:114860584-114860606 GGTCAGTTAAACCAAAGGGTAGG + Intronic
964697601 3:159527083-159527105 GGGCATCTGAACCAAAGGGCTGG - Intronic
965071068 3:163916150-163916172 GTGCAGATAAACCAAAAGATTGG + Intergenic
965372833 3:167885673-167885695 GTGAAGGTGAAAGAAAGAGTAGG - Intergenic
966230076 3:177642101-177642123 GGGCAGGTGAACGACAGGGCGGG + Intergenic
968933566 4:3597423-3597445 GTGCAGGTGTCCAACAGGGTCGG + Intergenic
969903401 4:10370906-10370928 GGGCAGGTGAATCAGAGGTTGGG - Intergenic
970975942 4:22042962-22042984 GTGTTGGTGAATAAAAGGGTAGG + Intergenic
972407199 4:38758085-38758107 GTGCCGGTGAGCCACAGAGTTGG - Intergenic
974043766 4:56880097-56880119 GTGAATGAGAACCAAAGTGTAGG + Intergenic
979604569 4:122624018-122624040 GTGGAGATGAACCTTAGGGTGGG + Intergenic
992153173 5:73926495-73926517 GTGCAGGTGAACCAAAGGGTAGG - Intronic
993968928 5:94393103-94393125 GTGCAGGTGAAGCAAATGATTGG + Intronic
994148579 5:96422190-96422212 GTGCCTGTGAACCATAGGCTTGG - Intronic
995063719 5:107838321-107838343 ATTCAGGTGGTCCAAAGGGTGGG - Intergenic
998310096 5:141121841-141121863 GTGCAGGTTTACCAACGGCTTGG + Exonic
1002285868 5:178162336-178162358 CAGCAGGGGAACCAGAGGGTGGG + Intergenic
1004526502 6:16413562-16413584 GTGAATGTGAATCAATGGGTGGG + Intronic
1005852544 6:29832606-29832628 TGGCAGGTGATCCAGAGGGTGGG + Intergenic
1005876133 6:30011129-30011151 TGGCAGGTGATCCAGAGGGTGGG + Intergenic
1008401770 6:51071655-51071677 GGGGAAGTGAACCAAAGGCTGGG - Intergenic
1011218581 6:85031232-85031254 GTGGAGGTAAGCCAAAGGCTTGG - Intergenic
1015292764 6:131557428-131557450 GTGAAGATGAAGCAAATGGTGGG + Intergenic
1016182639 6:141166207-141166229 GTTCAGAGGAACCAAAGGTTGGG - Intergenic
1016838088 6:148499391-148499413 GAGCATTTGAACCAAAGTGTAGG + Intronic
1017656418 6:156633788-156633810 CTGCAGATGAAGAAAAGGGTTGG + Intergenic
1022140060 7:27486139-27486161 GTGCAGGGGAAACAAAGGCCTGG + Intergenic
1022196204 7:28069684-28069706 TTGCCTGTGAACCAGAGGGTTGG - Intronic
1022553862 7:31271865-31271887 GTGAAGGTTAAACAAATGGTGGG + Intergenic
1024285934 7:47757629-47757651 AAGCAGGTGAAGCAAATGGTGGG + Intronic
1026545137 7:71315911-71315933 GTGCAGGTGAACAAAACAGTTGG - Intronic
1032435660 7:131898352-131898374 GTGCAGTTGTACAAGAGGGTAGG + Intergenic
1034788825 7:153949523-153949545 TTGCAGGTGAAGGAAAAGGTGGG + Intronic
1035202275 7:157275373-157275395 GTGCAGGTCCACCAAAGCGTGGG + Intergenic
1035819890 8:2579932-2579954 GAGCAGGTGAACCCAATGTTGGG + Intergenic
1040651694 8:49456367-49456389 ATGCATTTGAACCCAAGGGTTGG + Intergenic
1040886266 8:52266998-52267020 GGGCAGGTGCAGCAAAGGGCTGG + Intronic
1041075622 8:54166930-54166952 TTGAAGGTGAACCAGAGTGTTGG - Intergenic
1044762756 8:95539161-95539183 TTGCAGATGAGACAAAGGGTAGG - Intergenic
1045098637 8:98824605-98824627 GTTCAGGTGAAAAAAAGGGGGGG - Intronic
1046490595 8:114947831-114947853 GTGCAGGCGAACCTAATGGTAGG - Intergenic
1047421223 8:124709913-124709935 GTGCAGCTAAACCAGAGGGTAGG - Intronic
1053054769 9:34987966-34987988 GGGCAGATGAGCCATAGGGTGGG - Intergenic
1054456581 9:65434394-65434416 GTGCAGGTGTCCAACAGGGTCGG - Intergenic
1055938566 9:81626730-81626752 GTGCAGGTGACACACAGGGCCGG + Intronic
1056319041 9:85419449-85419471 GTGGATGAGAGCCAAAGGGTGGG + Intergenic
1057505653 9:95631429-95631451 GTGCAGGGGAGCCATAGGGAGGG - Intergenic
1058119276 9:101120550-101120572 GTGCAGTTGAATAAATGGGTGGG + Intronic
1061293174 9:129663862-129663884 GTGCAGGTGCACACATGGGTAGG - Intergenic
1062179124 9:135181247-135181269 GTGCTGGTGCACCAGAAGGTGGG + Intergenic
1190119201 X:47646788-47646810 GTGCAGGTGATACATAGGATAGG - Intronic
1192556544 X:72094571-72094593 GTGCCCTTGAACAAAAGGGTGGG - Intergenic
1193128330 X:77893284-77893306 CTTCAGGTGAATGAAAGGGTGGG + Intronic
1194621981 X:96184191-96184213 GTCCAGGTGAAACAAAGGTATGG - Intergenic
1198300873 X:135333210-135333232 GTGCAGGTGAACCTCAGGACCGG + Intronic