ID: 992154412

View in Genome Browser
Species Human (GRCh38)
Location 5:73940704-73940726
Sequence ATGGCCAAGCCCAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992154412_992154416 -3 Left 992154412 5:73940704-73940726 CCTTTCTCATTGGGCTTGGCCAT 0: 1
1: 0
2: 3
3: 29
4: 215
Right 992154416 5:73940724-73940746 CATTCTGTGGCTGACTATATGGG 0: 1
1: 0
2: 0
3: 14
4: 136
992154412_992154415 -4 Left 992154412 5:73940704-73940726 CCTTTCTCATTGGGCTTGGCCAT 0: 1
1: 0
2: 3
3: 29
4: 215
Right 992154415 5:73940723-73940745 CCATTCTGTGGCTGACTATATGG 0: 1
1: 0
2: 1
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992154412 Original CRISPR ATGGCCAAGCCCAATGAGAA AGG (reversed) Intronic
900289527 1:1918003-1918025 ATGGCCAAGCCCAGAGAGGAAGG - Exonic
900906181 1:5560875-5560897 ATTGCTAGGCCCAATGATAAGGG - Intergenic
900926342 1:5708638-5708660 AGGGCCAAGGCCAATAGGAAGGG - Intergenic
901149679 1:7092970-7092992 CTGGCCAAGCCCAGTAAGAATGG + Intronic
902557000 1:17252810-17252832 ATGGGAAAGCCCAGTGGGAATGG - Intronic
902988896 1:20172255-20172277 AGGGCCACGCCCCATGTGAAGGG + Intronic
902998541 1:20247422-20247444 ATGGCCAAGCCCAAAGTCAAGGG + Intergenic
903558429 1:24210278-24210300 AAGGCCATTCCCACTGAGAAGGG - Intergenic
903628523 1:24748307-24748329 GCCACCAAGCCCAATGAGAAAGG - Intronic
904459430 1:30666979-30667001 ATTTCCAAGACCAATTAGAAGGG + Intergenic
905355791 1:37383446-37383468 GTGGCCAAGCCCAAAGGCAAAGG + Intergenic
905801606 1:40847644-40847666 ATGGCCAAGCCCAAAGTCAGGGG - Intergenic
906269541 1:44464486-44464508 ATGGCCAAGCCCAAAGTCAGAGG + Intronic
906530262 1:46519927-46519949 TTGGCCAAGGCCTAAGAGAAGGG - Intergenic
907542131 1:55225294-55225316 AGGACCAATCCCAAAGAGAAAGG - Intergenic
908035790 1:60051323-60051345 ATGGCCAAGCACAACATGAATGG - Intronic
909854403 1:80510163-80510185 AAACCCAAGCCCTATGAGAATGG - Intergenic
912132709 1:106621337-106621359 AAGGCCAAGCACAAAGTGAAGGG - Intergenic
912340025 1:108905386-108905408 AGGGCAAAGCCCAACGGGAATGG - Intronic
913121867 1:115749746-115749768 AAGGCCAAGCCAAATGTGAGAGG - Intronic
913966430 1:143381214-143381236 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
913973539 1:143435505-143435527 ATGGCTAAGCCCAATGTCAGTGG - Intergenic
914060804 1:144206821-144206843 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
914067927 1:144261112-144261134 ATGGCTAAGCCCAATGTCAGTGG - Intergenic
914111228 1:144705242-144705264 ATGGCTAAGCCCAATGTCAGTGG + Intergenic
914118346 1:144759548-144759570 AGGGCCCAGTCCAAGGAGAAGGG - Intergenic
916045804 1:160999238-160999260 AGGGCCAAGGCCACAGAGAAAGG + Intronic
916579524 1:166095198-166095220 ATGGGCAAGCCCTTTGGGAACGG - Intronic
916597126 1:166254632-166254654 ATTGCCAAGCCCAAAGTCAATGG + Intergenic
918336870 1:183524491-183524513 ATTTCCATGCCCAGTGAGAAAGG + Intronic
919266527 1:195274343-195274365 ATGGCCAAGCCAAATCAAAAAGG - Intergenic
920533814 1:206724173-206724195 ATGCCCATGCCCAAGGAGCAGGG + Intronic
922133830 1:222805807-222805829 ATAGCCATTCCCAAGGAGAAGGG + Intergenic
922235816 1:223721703-223721725 AGGGACAAGACCAATGGGAAAGG + Intronic
922490519 1:226012845-226012867 ATAGAAAAGTCCAATGAGAAGGG + Intergenic
922495064 1:226050631-226050653 ATGGACAAGACTAATGTGAAAGG - Intergenic
922909390 1:229203075-229203097 ATGGGCAATTCCAATGAGAGAGG - Intergenic
923192520 1:231633515-231633537 ATGTGGAAGCCCAATGAGCAGGG - Intronic
923305754 1:232686664-232686686 ATGCCCAAGCCCTGTGCGAATGG + Intergenic
1063139729 10:3245429-3245451 ATGATCAAGGCCAAGGAGAAGGG + Intergenic
1065297255 10:24288910-24288932 TTAGGCAAGTCCAATGAGAAGGG + Intronic
1066305614 10:34137576-34137598 ATGGCCAAGGCCAACAACAATGG - Intronic
1068559630 10:58499093-58499115 ATGGCAAAGTGCAGTGAGAAAGG - Intergenic
1070402494 10:76065787-76065809 ATGGCCAAGGCCAAAGTCAATGG - Intronic
1070696037 10:78563734-78563756 ATGGCCAAGCCTAATGGGGTAGG - Intergenic
1070962623 10:80509669-80509691 CTGCCCAATCCCAATGGGAAAGG - Intronic
1070972455 10:80578805-80578827 ATGGTCAAGGCCAATGAGCAAGG + Intronic
1073976224 10:109104561-109104583 ATGCCCAACCACAATGAGGAGGG + Intergenic
1075665971 10:124231305-124231327 ATGGCCAAGCCCAATATAAATGG - Intergenic
1085360574 11:75881596-75881618 ATAGCAAAACCCAATGTGAAAGG - Intronic
1086971489 11:93085811-93085833 ATGGCCACTCCTAATGACAAAGG - Intergenic
1088441669 11:109877731-109877753 ATGGCCAAGCCCAACACCAATGG - Intergenic
1088447656 11:109949714-109949736 CTGCCCAAGACCCATGAGAATGG - Intergenic
1090650154 11:128799315-128799337 ATTACCAAGCCCATTGAGGAAGG - Intronic
1092903693 12:13083462-13083484 ATGACTAAGACGAATGAGAATGG - Intronic
1095316747 12:40771691-40771713 ATGGCCCTACCCAAGGAGAACGG + Intronic
1097739370 12:63221092-63221114 ATTGCCAACCCCATTGAGAAAGG - Intergenic
1098275236 12:68805976-68805998 AAGCACAAGGCCAATGAGAAGGG + Intergenic
1100396775 12:94192749-94192771 ATGGCCAAGCCCAATATCCATGG + Intronic
1101168744 12:102065831-102065853 ATTGCCATGCCCAGGGAGAAGGG - Intergenic
1101558512 12:105833357-105833379 ATAACAAAACCCAATGAGAAAGG + Intergenic
1101664504 12:106799172-106799194 ATGGCAAAGCCACTTGAGAAAGG - Intronic
1103727516 12:123005401-123005423 ATGGCCCAGTTCAATGAGGATGG - Exonic
1104949891 12:132434920-132434942 ATGGCTAAGCCTGGTGAGAAGGG - Intergenic
1107199179 13:37693181-37693203 ACTGACAATCCCAATGAGAAAGG - Intronic
1107645034 13:42485361-42485383 ACGGCCAAGCCCAAGGACAATGG - Intergenic
1108568070 13:51721357-51721379 TTAGCCAAGCCCAAGGAGTATGG + Intronic
1108637916 13:52354216-52354238 ATGCCCAAGCCCAAGTAAAATGG - Intergenic
1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG + Intergenic
1110614304 13:77523964-77523986 ATGGCCAACCCCATGTAGAAAGG - Intergenic
1110907098 13:80904978-80905000 ATGTACAAGCCCAAAGTGAATGG + Intergenic
1112187194 13:97138663-97138685 TTGGTCTAGCCCAATGGGAAGGG + Intergenic
1113950490 13:114068841-114068863 AGGGCCAAGGCCAGAGAGAAAGG + Intronic
1119177381 14:72579165-72579187 ATGGCCTATCCTAAGGAGAAGGG + Intergenic
1120247027 14:82019601-82019623 ATGGCCAAGCCCAACATCAATGG + Intergenic
1123936256 15:25195566-25195588 ATGGCCAGGCCACATGAGAGGGG + Intergenic
1126396510 15:48224038-48224060 CTGGCCATGCTCAAGGAGAAGGG - Intronic
1127959009 15:63877102-63877124 ATGGCCAAGCCCAACACCAATGG - Intergenic
1134913391 16:18049617-18049639 ACAGCCAAGCCCAAAGTGAAAGG + Intergenic
1136448695 16:30339999-30340021 GTGGCCAAGCCTAGTGACAATGG + Intergenic
1137222557 16:46470517-46470539 GATGCCAAGCCCAACGAGAAAGG + Intergenic
1137927564 16:52555208-52555230 ATGGCCAAGCCCCATGTCAATGG + Intergenic
1138087165 16:54143722-54143744 AAGGCCAAGCCCAATGTCAAGGG + Intergenic
1138927246 16:61607579-61607601 ATGGCATAGCACAATGAGCATGG + Intergenic
1142047167 16:87932864-87932886 GTGGCCAAGCCTAGTGACAATGG - Intronic
1143275713 17:5708230-5708252 ATGGCCAAGTCCAATACCAATGG - Intergenic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146736736 17:35244467-35244489 CTGGCCTCGCCCTATGAGAAGGG + Intronic
1146978578 17:37138208-37138230 ATGGCCAATCTGAATGAGAAGGG + Intronic
1147874485 17:43611422-43611444 ATGGCCAAGCCCAATGCTGCTGG + Intergenic
1149203983 17:54222457-54222479 ATGGCCAAGGCCAATGTTAAGGG - Intergenic
1149437106 17:56642557-56642579 ATGGCCAAACCCAAAGTTAAGGG + Intergenic
1149574226 17:57700021-57700043 ATGGCCAAGCCCAGATAGATGGG + Intergenic
1149996327 17:61407862-61407884 GTGGCCAAACCCAGTTAGAAGGG - Intronic
1151032352 17:70755780-70755802 ATGGCCAGGCCCTAAGGGAAAGG + Intergenic
1151270897 17:72995214-72995236 ATGGCCAAGCCCAAGGTCAAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155539579 18:26854465-26854487 GTGGCCACGCCCCCTGAGAAAGG + Exonic
1156242238 18:35265869-35265891 CTGACCAAGACCAAGGAGAAAGG + Intronic
1156528685 18:37794405-37794427 ATGGCCGACCCCGGTGAGAATGG - Intergenic
1156631651 18:38976518-38976540 ATTTCCAAGCCTAATGATAATGG - Intergenic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1157891153 18:51419433-51419455 ATGGCCATACCCAAAGGGAAGGG + Intergenic
1166577443 19:43855654-43855676 ATGGCCAAGCCCAACACCAATGG + Intergenic
1166805702 19:45485702-45485724 AAGCCAAAGCCGAATGAGAACGG - Exonic
1167497871 19:49830050-49830072 ATGGCCAACCCCAGAGAGAAGGG - Intronic
1202700212 1_KI270712v1_random:158709-158731 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
925222083 2:2150043-2150065 ATGGCAGAGCCCAAAGAGAGAGG - Intronic
925615068 2:5737281-5737303 GTTGCAAAGCACAATGAGAAAGG - Intergenic
926299359 2:11590939-11590961 ATGGCCAAACCCAATGGTCAGGG - Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926909861 2:17842554-17842576 GTGGCCAGCCCCATTGAGAAGGG + Intergenic
927292688 2:21420202-21420224 ATCGCCCAGCCCAACAAGAATGG - Intergenic
928624131 2:33122090-33122112 ATGGCCAAGCCCAGAGTCAAGGG - Intronic
928937208 2:36691440-36691462 ATGACCAAGCCCAAAGTCAAGGG - Intergenic
929014781 2:37483308-37483330 ATGGCCAAGCCCAACATGACTGG + Intergenic
930449744 2:51520170-51520192 ATGGCCAAGCCCAAAATCAAGGG + Intergenic
930678766 2:54232929-54232951 ACAGCCAAGCCCTATCAGAATGG + Intronic
931212784 2:60213682-60213704 GTGGCCATGCCCAATGGCAATGG - Intergenic
933069032 2:77834977-77834999 AATGCCAAGTCCCATGAGAAGGG - Intergenic
933301858 2:80549759-80549781 ATGAACATGCCCATTGAGAAGGG - Intronic
933807790 2:86012510-86012532 ATGGCCAAGCCCCCTGGGGACGG - Intergenic
934171144 2:89542184-89542206 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
934178235 2:89596471-89596493 ATGGCTAAGCCCAATGTCAGTGG - Intergenic
934281450 2:91616502-91616524 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
934288532 2:91670763-91670785 ATGGCTAAGCCCAATGTCAGTGG - Intergenic
935490087 2:103708674-103708696 ATTTCCAAGGCCAATGAGATGGG + Intergenic
936709890 2:115120242-115120264 AATGCCAAGTCCTATGAGAAGGG + Intronic
939364960 2:141219372-141219394 GAGGCCCTGCCCAATGAGAAAGG - Intronic
941238620 2:163009222-163009244 ATTTACAAGCCCAATAAGAAGGG - Intergenic
942058937 2:172210009-172210031 AAGGCCAACCCAGATGAGAAGGG - Intergenic
943004528 2:182373317-182373339 AAGGCAAAGCCAAATGACAAGGG + Intronic
944283077 2:197920866-197920888 ATTTCCCAGCTCAATGAGAAAGG + Intronic
944354699 2:198773354-198773376 ATGGTCAATCTCAATGTGAAGGG + Intergenic
944689938 2:202149638-202149660 ATGGGGAACCCCAATTAGAAAGG + Intronic
946471936 2:219968700-219968722 ATGGCCAAACCCAAAGTCAAAGG - Intergenic
1168787174 20:549834-549856 ATGGCCAAGCCTAATATTAATGG - Intergenic
1168880084 20:1198975-1198997 ATGGCCAAGCCCAAAGCTAAGGG - Intergenic
1169272404 20:4210708-4210730 ATGGCCAAGCCCAAAGCCAATGG - Intergenic
1169279948 20:4258345-4258367 ATGGCCAAGCTCAATGTCAAGGG - Intergenic
1170733706 20:18995326-18995348 ATGGCCAAGGACCATGACAAGGG + Intergenic
1170746398 20:19102977-19102999 ATGGACAAGCCCAAAGTCAAAGG + Intergenic
1171377734 20:24705081-24705103 ATGGCCAAGCCCAGAGTCAATGG + Intergenic
1172897327 20:38309617-38309639 GTGGCCAAGCCCAAAGTCAAGGG + Intronic
1173311114 20:41896829-41896851 ATGGCCAAGCCCAACATCAATGG + Intergenic
1173402115 20:42734922-42734944 ATGGCCAAGCTCAAGGTCAATGG + Intronic
1174068924 20:47886432-47886454 ATGGCCAAGCCCAAAGTCAGTGG - Intergenic
1174531275 20:51216370-51216392 ATGGCTAAGCCCAAGGTCAAAGG + Intergenic
1179446944 21:41438618-41438640 GTGGCCAAGCCCAATTTCAAGGG + Intronic
1179896073 21:44364467-44364489 ATGGCCAAGCACTCTGAGAGTGG - Intronic
1181104405 22:20565212-20565234 ATGCCCAAGCCCAAATGGAAGGG - Intronic
1182085995 22:27561582-27561604 ATGGCCCTGCCCCATGAGGATGG + Intergenic
1182623681 22:31631018-31631040 AGGGCCAAGGCCAGGGAGAAGGG + Intronic
949856884 3:8470011-8470033 ATGACCAAGCCCAAAGAGAAGGG - Intergenic
951342537 3:21506155-21506177 ATGGCCAAGCCTGATTACAATGG - Intronic
951655985 3:25009071-25009093 AGGGACAAGCCAAATTAGAAGGG - Intergenic
952842605 3:37661028-37661050 ATGGCCAAACCCAAAGTCAAGGG + Intronic
953371790 3:42394688-42394710 TTGCCCAAGCCCACTGATAATGG - Intergenic
953477157 3:43215280-43215302 ATGGTCAAGCCCAAAGTCAAAGG + Intergenic
954725251 3:52602807-52602829 ATGGCAAACCCCAAAAAGAAGGG - Intronic
956725446 3:72152897-72152919 ATGGACAGTCCCAAAGAGAATGG + Intergenic
958886276 3:99731362-99731384 ATGGCAAAGCCCTATAAGTAAGG + Intronic
959598233 3:108151007-108151029 ATGGGAAATTCCAATGAGAATGG + Intergenic
960404595 3:117244424-117244446 CTGACCAAGGACAATGAGAAAGG - Intergenic
963535117 3:146518143-146518165 ATGGCCAAGCCTAATTATGAAGG - Intronic
964000504 3:151765829-151765851 ATGACCAAGCACAATGGAAAGGG + Intergenic
969028620 4:4193704-4193726 AGGGCCCAGTCCAAGGAGAAGGG - Intronic
969831009 4:9796925-9796947 ATGGCTAAGCCCAATGTCAGTGG + Intronic
970215192 4:13751661-13751683 ATGGGCAAACCCAGTGAGGACGG + Intergenic
972341798 4:38158423-38158445 CTGGTCCAGCCCAAAGAGAATGG - Intergenic
973628989 4:52801500-52801522 ATGGACAAGAACATTGAGAATGG - Intergenic
974876417 4:67708418-67708440 ATTGGCAAGCCTAATGAAAATGG - Intergenic
976105545 4:81613312-81613334 AGAGCCAAGACCAATGAGAAGGG - Intronic
979353046 4:119668582-119668604 ACTGCAAAGCCCAAAGAGAAAGG + Intergenic
981873897 4:149518114-149518136 ATGGCCAAGCCCAACACCAAAGG + Intergenic
982529882 4:156526421-156526443 ATGGCAAAGCCCAATGCTGAGGG + Intergenic
986226425 5:5819305-5819327 TTTGCCAAGTCCAAAGAGAAGGG - Intergenic
986425349 5:7625914-7625936 ATGGCTAAGCCCAAAGTCAAGGG + Intronic
987768799 5:22272551-22272573 ATGGTTAAGCTTAATGAGAAAGG - Intronic
990268355 5:54104975-54104997 ATGGCTGAGACTAATGAGAAGGG - Intronic
990728076 5:58778449-58778471 ATGCCCATGCCCAATAAGAAAGG + Intronic
991612956 5:68467469-68467491 ATGGCTAAGCCCACTGCCAAAGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
992763086 5:79969013-79969035 AAGGCTAAGCCCAATGAGGTAGG - Intergenic
993376446 5:87154357-87154379 ATGGCAGAGCCCAGTGCGAAGGG - Intergenic
995731978 5:115255146-115255168 ATGGCAAAGACCAAGGATAATGG - Intronic
996612572 5:125400301-125400323 ATGGCCAAGCCTAATATCAAAGG - Intergenic
999107022 5:149082090-149082112 ATTGCCAAGACCAATGTCAAGGG - Intergenic
999135172 5:149313937-149313959 ATGGCTAAGCTCAGAGAGAAAGG + Intronic
1001664897 5:173424439-173424461 AAGCCCAAGCCCCATGAGAAAGG + Intergenic
1001859167 5:175038074-175038096 ATGGCCAAGCTCAATGTTAAAGG + Intergenic
1002479546 5:179491003-179491025 TTGGCCAAGCCCAAAGTCAAGGG - Intergenic
1004239689 6:13909286-13909308 ATGCCTAAGGCCAATCAGAAAGG + Intergenic
1004258724 6:14089055-14089077 ATGGCCCAGCCCAAGGTCAAGGG + Intergenic
1008669164 6:53749135-53749157 GTGGCCAAGCCCAAAGTCAAGGG - Intergenic
1010697598 6:78995987-78996009 ATAGTTAAGCCCAATGATAAAGG + Intronic
1016916632 6:149250057-149250079 ATAGCAAAACTCAATGAGAAGGG + Intronic
1019766676 7:2856502-2856524 AAGGTCAAGCCCAAAGACAATGG - Intergenic
1020333068 7:7039899-7039921 ATGGCCAAGCCCAATGTTAAGGG + Intergenic
1021417822 7:20408436-20408458 AAGGCCAAGCTCAGTGATAAGGG - Intronic
1021909236 7:25367836-25367858 ATGGCCAAGCCTAATGTCAATGG + Intergenic
1021989811 7:26130516-26130538 ATGGCCAAGCCCCTGGGGAAGGG - Intergenic
1022844729 7:34198558-34198580 ATGGCCAAGTCCAATGCCAGTGG + Intergenic
1023125335 7:36949444-36949466 GTGGCCATGCACATTGAGAAGGG - Intronic
1023442407 7:40197698-40197720 ATGGCCAAGTCCAATACCAATGG + Intronic
1029712715 7:102308410-102308432 CTGGCCAAGCACACTGAGTAGGG - Intronic
1030033101 7:105387567-105387589 AGGACCAAGGCCAACGAGAAGGG + Intronic
1032407596 7:131667905-131667927 GTGGCCAAGCCCAATATGAATGG - Intergenic
1032448405 7:132004343-132004365 ATGACCAAGCCCAAAGAGGAGGG - Intergenic
1032699343 7:134365091-134365113 ATGGGTTAGCCCAATGAGATGGG + Intergenic
1034992811 7:155558877-155558899 ATGGCCGAGCCCAATGTCAGTGG - Intergenic
1035273676 7:157734706-157734728 ATTTCGAAGCCAAATGAGAATGG - Intronic
1036452086 8:8877758-8877780 AGAGCCCAGCCCAATGACAAAGG + Intronic
1038691476 8:29767640-29767662 ATGGCCAAGCCCAAGAGCAATGG - Intergenic
1038713564 8:29971816-29971838 ATGGCCAAGCCCCAAGTCAAGGG - Intergenic
1039171596 8:34753455-34753477 ATGGGCAAGCCCAAAGTCAACGG - Intergenic
1040525970 8:48225650-48225672 ATGGCTAAGCCCTCTGTGAAAGG - Intergenic
1040909178 8:52501203-52501225 ATGGCCAAGGACAAAGAGAGGGG + Intergenic
1042187147 8:66148139-66148161 ATGGTCAAGTCCAAGGAGATTGG + Intronic
1044444504 8:92258669-92258691 ATGGCCACGCCCAAAGTCAAGGG + Intergenic
1044704349 8:94994135-94994157 ATGGCCAAGCCCAACATAAATGG - Intronic
1047027253 8:120837280-120837302 ATGGCCAAGCCCAAAGTCAATGG - Intergenic
1047400261 8:124540217-124540239 ATGGCCAAGTACAATGTGATGGG + Intronic
1047534309 8:125705230-125705252 ATGGCCAGGCCTGATGACAATGG + Intergenic
1048336018 8:133502897-133502919 ATGGCCAAGCCCAATGTCAGTGG - Intronic
1048742367 8:137575534-137575556 ATGGCCAAGCCCCCTAGGAATGG - Intergenic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1052085125 9:24255855-24255877 ATTGGCTGGCCCAATGAGAAAGG + Intergenic
1053747225 9:41211034-41211056 ATAGCCAAGCACTGTGAGAATGG - Intergenic
1055499328 9:76887561-76887583 ATGGCCAAGCCCAATAGCAGTGG - Intronic
1056133299 9:83606457-83606479 ATGGCCAAGCCCAAAGACAAGGG + Intergenic
1056438437 9:86596152-86596174 ATGGCCAAGCTCAAAGTCAAGGG + Intergenic
1059754818 9:117282589-117282611 ATGGCCAAGCCCAGAGCCAATGG - Intronic
1060428721 9:123528625-123528647 ATGGCAGAGGCCAGTGAGAAGGG - Intronic
1061796573 9:133088866-133088888 ATGGCCAAGCCACGTCAGAAGGG + Intergenic
1186535139 X:10339373-10339395 ATCTCCAAGCCTAGTGAGAAAGG + Intergenic
1188481402 X:30640217-30640239 ATGGCTAGGCCCAAAGACAAGGG - Intergenic
1188572336 X:31602969-31602991 GTGGCCAAGCCCAAAGTCAAGGG - Intronic
1188577045 X:31664056-31664078 ATGACCAAGCTCAATGTCAAGGG - Intronic
1188833576 X:34930648-34930670 ATGATTAAGCCTAATGAGAAAGG + Intergenic
1188982197 X:36736416-36736438 ATGGCCAACCACACTGAGAAGGG - Intergenic
1192085259 X:68089749-68089771 ATGTCCAAACCCAATGAGATAGG - Intronic
1192545159 X:72006935-72006957 ATTGCCCAGCCCAGTGTGAATGG + Intergenic
1194937885 X:99972948-99972970 ATGACCAAGGCCAAGGAGAGAGG - Intergenic
1197124586 X:122929440-122929462 ATGGCCAAGCCCAACATCAAGGG + Intergenic
1197667179 X:129236702-129236724 TTGGCCAAGCACATTGTGAATGG - Intergenic
1198541396 X:137643866-137643888 ATGGCCAAGTCCAAAGTCAATGG + Intergenic
1198921709 X:141736006-141736028 ATGCCCCAGCCCAATCAGTAAGG - Intergenic