ID: 992156777

View in Genome Browser
Species Human (GRCh38)
Location 5:73963285-73963307
Sequence AAAACAAAAACTATTAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156777_992156780 0 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156780 5:73963308-73963330 TGTTTGGTACACAGTAGTCATGG No data
992156777_992156783 30 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156783 5:73963338-73963360 TATGACAAGAATAATAAGGTGGG No data
992156777_992156782 29 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156782 5:73963337-73963359 TTATGACAAGAATAATAAGGTGG No data
992156777_992156781 26 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156781 5:73963334-73963356 ATATTATGACAAGAATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156777 Original CRISPR AAAACAAAAACTATTAGTTT GGG (reversed) Intergenic
No off target data available for this crispr