ID: 992156778

View in Genome Browser
Species Human (GRCh38)
Location 5:73963286-73963308
Sequence AAAAACAAAAACTATTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156778_992156784 30 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156784 5:73963339-73963361 ATGACAAGAATAATAAGGTGGGG No data
992156778_992156780 -1 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156780 5:73963308-73963330 TGTTTGGTACACAGTAGTCATGG No data
992156778_992156783 29 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156783 5:73963338-73963360 TATGACAAGAATAATAAGGTGGG No data
992156778_992156782 28 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156782 5:73963337-73963359 TTATGACAAGAATAATAAGGTGG No data
992156778_992156781 25 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156781 5:73963334-73963356 ATATTATGACAAGAATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156778 Original CRISPR AAAAACAAAAACTATTAGTT TGG (reversed) Intergenic
No off target data available for this crispr