ID: 992156780

View in Genome Browser
Species Human (GRCh38)
Location 5:73963308-73963330
Sequence TGTTTGGTACACAGTAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156776_992156780 13 Left 992156776 5:73963272-73963294 CCTGTGATAGCTTCCCAAACTAA No data
Right 992156780 5:73963308-73963330 TGTTTGGTACACAGTAGTCATGG No data
992156778_992156780 -1 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156780 5:73963308-73963330 TGTTTGGTACACAGTAGTCATGG No data
992156777_992156780 0 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156780 5:73963308-73963330 TGTTTGGTACACAGTAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156780 Original CRISPR TGTTTGGTACACAGTAGTCA TGG Intergenic
No off target data available for this crispr