ID: 992156781

View in Genome Browser
Species Human (GRCh38)
Location 5:73963334-73963356
Sequence ATATTATGACAAGAATAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156777_992156781 26 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156781 5:73963334-73963356 ATATTATGACAAGAATAATAAGG No data
992156778_992156781 25 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156781 5:73963334-73963356 ATATTATGACAAGAATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156781 Original CRISPR ATATTATGACAAGAATAATA AGG Intergenic
No off target data available for this crispr