ID: 992156782

View in Genome Browser
Species Human (GRCh38)
Location 5:73963337-73963359
Sequence TTATGACAAGAATAATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156777_992156782 29 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156782 5:73963337-73963359 TTATGACAAGAATAATAAGGTGG No data
992156778_992156782 28 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156782 5:73963337-73963359 TTATGACAAGAATAATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156782 Original CRISPR TTATGACAAGAATAATAAGG TGG Intergenic
No off target data available for this crispr