ID: 992156783

View in Genome Browser
Species Human (GRCh38)
Location 5:73963338-73963360
Sequence TATGACAAGAATAATAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156778_992156783 29 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156783 5:73963338-73963360 TATGACAAGAATAATAAGGTGGG No data
992156777_992156783 30 Left 992156777 5:73963285-73963307 CCCAAACTAATAGTTTTTGTTTT No data
Right 992156783 5:73963338-73963360 TATGACAAGAATAATAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156783 Original CRISPR TATGACAAGAATAATAAGGT GGG Intergenic
No off target data available for this crispr