ID: 992156784

View in Genome Browser
Species Human (GRCh38)
Location 5:73963339-73963361
Sequence ATGACAAGAATAATAAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992156778_992156784 30 Left 992156778 5:73963286-73963308 CCAAACTAATAGTTTTTGTTTTT No data
Right 992156784 5:73963339-73963361 ATGACAAGAATAATAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992156784 Original CRISPR ATGACAAGAATAATAAGGTG GGG Intergenic
No off target data available for this crispr